View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20563_low_14 (Length: 237)
Name: NF20563_low_14
Description: NF20563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20563_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 39167424 - 39167644
Alignment:
| Q |
1 |
ccagaggtctggatcaaaatattggtccccaaagaacccattgccatcggagttactacagcaccatcctggctgtgtcacatggttgtccaaaatcacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167424 |
ccagaggtctggatcaaaatattggtccccaaagaacccattgccatcggagttactacagcaccatcctggctgtgtcacatggttgtccaaaatcacc |
39167523 |
T |
 |
| Q |
101 |
atcaagtccatgtctcctagactttttaccaccgtctgcggcaattaattaactaataatactgttagaactctttttcatccttgtaactgcattgttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39167524 |
atcaagtccatgtctcctagactttttaccaccgtctgcggcaattaattaactaataatactgttagaactctttttcatccttgtaactgcattgttt |
39167623 |
T |
 |
| Q |
201 |
aaactaactataacaagttat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
39167624 |
aaactaactataacaagttat |
39167644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 14 - 104
Target Start/End: Original strand, 37315178 - 37315268
Alignment:
| Q |
14 |
tcaaaatattggtccccaaagaacccattgccatcggagttactacagcaccatcctggctgtgtcacatggttgtccaaaatcaccatca |
104 |
Q |
| |
|
|||||||||||||| ||||| |||||||||||||| || ||||| |||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
37315178 |
tcaaaatattggtcaccaaaaaacccattgccatcagaattactgcagcaccatcctggctgtgttatgtggttgtccaaaatcaccatca |
37315268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University