View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20563_low_17 (Length: 227)
Name: NF20563_low_17
Description: NF20563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20563_low_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 6e-67; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 79 - 211
Target Start/End: Complemental strand, 49954447 - 49954315
Alignment:
| Q |
79 |
actttcaaagctctttatcttctaccatcactcaactagcctctatattgcagtctcaaactgaaagtctcacaaattttgtggaaacctctagttttat |
178 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49954447 |
actttcaaagctctttatcttctaccatcactcaactagcctctatattgcagtctcaaactgaaagtctcacaaattttgtggaaacctctagttttat |
49954348 |
T |
 |
| Q |
179 |
cttcccttctaaaagaaagggtgtttatctcat |
211 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
49954347 |
cttcccttctaaaagaaagggtgtttttctcat |
49954315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 79 - 113
Target Start/End: Original strand, 49976404 - 49976438
Alignment:
| Q |
79 |
actttcaaagctctttatcttctaccatcactcaa |
113 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
49976404 |
actttcaaagctctttatcttctacaatcactcaa |
49976438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University