View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20563_low_4 (Length: 472)
Name: NF20563_low_4
Description: NF20563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20563_low_4 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 146; Significance: 1e-76; HSPs: 4)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 146; E-Value: 1e-76
Query Start/End: Original strand, 66 - 243
Target Start/End: Original strand, 7421168 - 7421346
Alignment:
| Q |
66 |
attgagatctctacttcaactgtctatccacaagacacaaatatcagttagcatgttttaatcaatgtgtctgtcagttaccaaaaataaggaaagctgt |
165 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7421168 |
attgagatctctacttcaactgtctatccacaagacacaaatatcagttagcatgttttaatcaatgtgtctgtcagttaccaaaaataaggaaagctgt |
7421267 |
T |
 |
| Q |
166 |
cgtttccctcttcaccttcaatgtgcnnnnnnngt-aaccaaaccaatctcaagaacaaacctaaaccttgttacaccg |
243 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
7421268 |
cgtttccctcttcaccttcaatgtgcaaaaaaagtaaaccaaaccaatctcaagaacaaaccaaaaccttgttacaccg |
7421346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 14 - 69
Target Start/End: Original strand, 7421088 - 7421143
Alignment:
| Q |
14 |
aaaacatgtaactcttaccattcgatctccggtttggtttttaaaacattagattg |
69 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7421088 |
aaaacatgtaactcttaccattcgatctccggtttggtttttaaaacattagattg |
7421143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 150 - 191
Target Start/End: Complemental strand, 13028267 - 13028226
Alignment:
| Q |
150 |
aaataaggaaagctgtcgtttccctcttcaccttcaatgtgc |
191 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
13028267 |
aaataaggaaagttgttgtttccctcttcaccttcaatgtgc |
13028226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 368 - 398
Target Start/End: Original strand, 7421490 - 7421520
Alignment:
| Q |
368 |
agaaaatggcttataatcccaaccttaacaa |
398 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
7421490 |
agaaaatggcttataatcccaaccttaacaa |
7421520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University