View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20563_low_9 (Length: 326)
Name: NF20563_low_9
Description: NF20563
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20563_low_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 21 - 314
Target Start/End: Original strand, 5139535 - 5139826
Alignment:
| Q |
21 |
tatcatggactaaaatcaaagttcgtaaaatactagggatcaaaatcatggnnnnnnncacgattttggcgctatgaatcaccgtcagaatatgttcata |
120 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||| | |||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
5139535 |
tatcatggactaaaatcaaagttcgtaaaatgctagggatcaaaatcaggaaaaaaaacacgatcttggcgctatgaatcaccgtcagaatatgttcata |
5139634 |
T |
 |
| Q |
121 |
tttttaagagcctttaaacatgatgtttccattatgtttaacacattatgttacaattgatgtgctctagtgtttctgcgttgtaatccatcactaatgt |
220 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5139635 |
tttttaagagcctgtaaacactatgtttccattatgtttaacacattatgttacaattgatttgctctagtgtttctgcgttgtaatccatcactaatgt |
5139734 |
T |
 |
| Q |
221 |
tggtttaccttgtatcatatatgttgaggtttattgatccttcgaagagtacttgtgatatcgttatgattattttttgttggccactcatatt |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
5139735 |
tggtttaccttgtatcatatatgttgaggtttattgatcctacgaaga--acttgtgatattgttatgattattctttgttggccactcatatt |
5139826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University