View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20564_high_24 (Length: 217)
Name: NF20564_high_24
Description: NF20564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20564_high_24 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 8 - 193
Target Start/End: Original strand, 20898973 - 20899158
Alignment:
| Q |
8 |
gtgagatgaaacaaaggaatgttggagattttcccgatgacaacaacttgttcacgtcatttgctgaaatggccaagagggtatggcttctgcattgctt |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20898973 |
gtgacatgaaacaaaggaatgttggagattttcccgatgacaacaacttgttcacgtcatttgctgaaatggccaagagggtatggcttctgcattgctt |
20899072 |
T |
 |
| Q |
108 |
agcgttttcttttgaacctcaagctgaaatatttcaaatagggaaaggttgtagattctctgatgtatacatggagagtgttgtaa |
193 |
Q |
| |
|
||| ||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20899073 |
agcattttcttttgagcctcaagctgaaatctttcaaatagggaaaggttgtagattctctgatgtatacatggagagtgttgtaa |
20899158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 67 - 188
Target Start/End: Original strand, 31767027 - 31767148
Alignment:
| Q |
67 |
tttgctgaaatggccaagagggtatggcttctgcattgcttagcgttttcttttgaacctcaagctgaaatatttcaaatagggaaaggttgtagattct |
166 |
Q |
| |
|
|||||||||||||| |||||||| | || ||||||| ||||| ||||||||||| |||||||||||| |||||| | || ||||| |||||||| | |
|
|
| T |
31767027 |
tttgctgaaatggctaagagggtttatctcttgcattgtttagccttttcttttgaggttcaagctgaaatctttcaagtgggaaaagggtgtagatttt |
31767126 |
T |
 |
| Q |
167 |
ctgatgtatacatggagagtgt |
188 |
Q |
| |
|
||||||| |||||||| ||||| |
|
|
| T |
31767127 |
ctgatgtgtacatggaaagtgt |
31767148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University