View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20564_high_25 (Length: 201)

Name: NF20564_high_25
Description: NF20564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20564_high_25
NF20564_high_25
[»] chr2 (1 HSPs)
chr2 (18-185)||(18507256-18507419)


Alignment Details
Target: chr2 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 18 - 185
Target Start/End: Complemental strand, 18507419 - 18507256
Alignment:
18 gttatgagtccagattgaaaactatgattggtttgataaggatgacaattgatctgaaagcttcttgggaatatatgccatactgttgaagttggagtta 117  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||   ||||||||||||    
18507419 gttatgagtccagattgaaaactatgattggtt-gataaggatgacaattgatctgaaagtttcttgggaatatatgccatgctg---aagttggagtta 18507324  T
118 cggtaaaaagctttaatagaatatattgggtggactgtcaaaaaagaagaatatattggacagaacat 185  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
18507323 cggtaaaaagctttaatagaatatattgggtggactgtcaaaaaagaagaatatattggacagaacat 18507256  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University