View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20564_high_4 (Length: 430)
Name: NF20564_high_4
Description: NF20564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20564_high_4 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 354; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 354; E-Value: 0
Query Start/End: Original strand, 19 - 423
Target Start/End: Complemental strand, 47624863 - 47624458
Alignment:
| Q |
19 |
tcaatgggatgaaggatctgctagatagtggtacgaagattcaggctgttcaagcatggggatggtttattcgaatgctcgggtcccatgctttgaaaaa |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624863 |
tcaatgggatgaaggatttgctagatagtggtacgaagattcaggctgttcaagcatggggatggtttattcgaatgctcgggtcccatgctttgaaaaa |
47624764 |
T |
|
| Q |
119 |
caagcatttagttaatgatatgttgaaaatacctgagcgtacatttacagatcctgaccctcaagttcagattgccacacaggtaccatatatcagttac |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624763 |
caagcatttagttaatgatatgttgaaaatacctgagcgtacatttacagatcctgaccctcaagttcagattgccacacaggtaccatatatcagttac |
47624664 |
T |
|
| Q |
219 |
tgcattatcccatgaatgattcgtagtggtgagttatgtgtagatgcaattctagtcagattttatgtgacaaacataaagcggcttaacaaagcttgat |
318 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
47624663 |
tgcattatcccatgaatgattcgtagtggtgagttatgtgtagatgcaattctagtcagattttatgtgacaaacataaagcagcttaacaaagcttgat |
47624564 |
T |
|
| Q |
319 |
taacatttgaagaccgatgaatagtgcactcacttgtta-nnnnnnnngtaagcaaagaaaaatgtgaaacaatcgagcactcactagctgttggcatat |
417 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47624563 |
taacatttgaagaccgatgaatagagcactcacttgttatttttttttgtaagcaaagaaaagtgtgaaacaatcgagcactcactagctgttggcatat |
47624464 |
T |
|
| Q |
418 |
tcttcg |
423 |
Q |
| |
|
| |||| |
|
|
| T |
47624463 |
tgttcg |
47624458 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University