View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20564_high_8 (Length: 382)
Name: NF20564_high_8
Description: NF20564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20564_high_8 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 325; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 325; E-Value: 0
Query Start/End: Original strand, 18 - 362
Target Start/End: Complemental strand, 51366921 - 51366577
Alignment:
| Q |
18 |
ggtgggtactttggtgtggttgttgaaaactctagtggttaaagttttagcttcttcttttcatgtgagtacatactttgataggattcaagagtcactg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51366921 |
ggtgggtactttggtgtggttgttgaaaactctagtggttaaagttttagcttcttcttttcatgtgagtacatactttgataggattcaagagtcactg |
51366822 |
T |
 |
| Q |
118 |
tttaatcagtttgtgatcgaaacactctcaggtccgcctttggtggagattcgaaaggcggaagaggaagaggaaaggcttgctgatgaggttcagaagt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51366821 |
tttaatcagtttgtgatcgaaacactctcaggtccgcctttggtggagattcgaaaggcggaagaggaagaggaaaggcttgctgatgaggttcagaagt |
51366722 |
T |
 |
| Q |
218 |
tgcaaaatgctggtgttagcatacctgctgatctaagagctagtgactttcctaaaatcaagagtggaaggttgagaattggaacgcttcagaaaagccc |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||| | ||||| ||||||||||||||| |
|
|
| T |
51366721 |
tgcaaaatgctggtgttagcatacctgctgatctaagagctagtgcctttcctaacatcaagagtggaaggttgaggagtggaatgcttcagaaaagccc |
51366622 |
T |
 |
| Q |
318 |
tgtggttaaaagtggcaagttttcaatgccgctttccaagaaatc |
362 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51366621 |
tgtggttaaaagtggcaagttttcaatgccgctttccaagaaatc |
51366577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University