View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20564_low_22 (Length: 240)
Name: NF20564_low_22
Description: NF20564
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20564_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 113; Significance: 2e-57; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 113; E-Value: 2e-57
Query Start/End: Original strand, 108 - 224
Target Start/End: Original strand, 22622807 - 22622923
Alignment:
| Q |
108 |
tggttaggtaatcaaatagatagaaacatataaatttgatgaatgaacttttggtgctgtccattgctactacggttgttgctgtctgctgttttctggt |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22622807 |
tggttaggtaatcaaatagatagaaacatataaatttgatgaatgaacttttggtgctgtccactgctactacggttgttgctgtctgctgttttctggt |
22622906 |
T |
 |
| Q |
208 |
ttttggtgcggtctctg |
224 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
22622907 |
ttttggtgcggtctctg |
22622923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 1 - 79
Target Start/End: Original strand, 22622698 - 22622778
Alignment:
| Q |
1 |
tgcctcccggaactatacctgagaaaa--gtgtgaatgacctcctccctctttgcaaaacgaactgtctgcaaccctttgg |
79 |
Q |
| |
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22622698 |
tgcctcccggaactatagctgagaaaaaagtgtgaatgacctcctccctctttgcaaaacgaactgtctgcaaccctttgg |
22622778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 40; Significance: 0.00000000000009; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 1 - 69
Target Start/End: Complemental strand, 15146777 - 15146707
Alignment:
| Q |
1 |
tgcctcccggaactatacctgaga--aaagtgtgaatgacctcctccctctttgcaaaacgaactgtctgc |
69 |
Q |
| |
|
||||||||||||| || ||||||| |||||||| |||||||||||| |||||||||||||||| |||||| |
|
|
| T |
15146777 |
tgcctcccggaaccattcctgagataaaagtgtggatgacctcctccgtctttgcaaaacgaacagtctgc |
15146707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 118 - 158
Target Start/End: Complemental strand, 15145751 - 15145711
Alignment:
| Q |
118 |
atcaaatagatagaaacatataaatttgatgaatgaacttt |
158 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
15145751 |
atcaaatagatagaaatatataaatttgatgaatgaacttt |
15145711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 115 - 158
Target Start/End: Complemental strand, 11318355 - 11318312
Alignment:
| Q |
115 |
gtaatcaaatagatagaaacatataaatttgatgaatgaacttt |
158 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||| |
|
|
| T |
11318355 |
gtaatcaaatagatagaaatagataaatttgatgaatgaacttt |
11318312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University