View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20565_high_4 (Length: 205)
Name: NF20565_high_4
Description: NF20565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20565_high_4 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 13 - 187
Target Start/End: Complemental strand, 40828246 - 40828069
Alignment:
| Q |
13 |
attattctcaaagagtcatgaactagtttatgatttgaaaaag---tgtgaatggaacttttgatcacacacttgaatagtttctatcttgccttttttg |
109 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40828246 |
attattctcaaagagtcatgaactagtttatgatttgaaaaagaagtgtgaatggaacttttgatcacacacttgaatagtttctatcttgccttttttg |
40828147 |
T |
 |
| Q |
110 |
tttagaatacattttttcagttcaaggaaaccaaacctcaactttacactatttttgagtaatatgtgatgtgaaaga |
187 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40828146 |
ttgagaatacattttttcagttcaaggaaaccaaacctcaactttacactatttttgagtaatatgtgatgtgaaaga |
40828069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University