View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20565_low_2 (Length: 311)
Name: NF20565_low_2
Description: NF20565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20565_low_2 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 12 - 293
Target Start/End: Original strand, 38858439 - 38858720
Alignment:
| Q |
12 |
gaatattggcgcccaaaaattatttttgttacagctagtagcaatggaaacctatttgcatcgatgctacaacaaacaaatcaacgtttgatcgagcttt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38858439 |
gaatattggcgcccaaaaattatttttgttacagctagtagcattggaaacctatttgcatcgatgctacaacaaacaaatcaacgtttgatcgagcttt |
38858538 |
T |
 |
| Q |
112 |
tgctaattttgtccgtgtgtttatagacatgggttttactaagcaagtgagatataaggtcttggttggaaggaagggtttttagtttttgccaaaatgg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38858539 |
tgctaattttgtccgtgtgtttatagacatgggttttactaagcaagtgagatataaggtcttggttggaaggaagggtttttcgtttttgccaaaatgg |
38858638 |
T |
 |
| Q |
212 |
attttgaatacacctacttgatttttgttcatattgcaaatgtactggtcactttatggacaattgcaaaagagtcaatgtt |
293 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38858639 |
attttgaatacacctacttgatttttgttcatattgcaaatgtactggtcactttatggacaattgcaaaagagtcaatgtt |
38858720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University