View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20565_low_3 (Length: 249)
Name: NF20565_low_3
Description: NF20565
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20565_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 17 - 224
Target Start/End: Original strand, 11773805 - 11774013
Alignment:
| Q |
17 |
gaacaaaggtaaacattgttagctcataaacttcttgtttatcaatttcttatttttt-gcatgtgttcttttagnnnnnnnngtttgaaagtttgattg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
11773805 |
gaacaaaggtaaacattgttagctcataaacttcttgtttatcaatttcttatttttttgcatgtgttcttttagttttttttgtttgaaagtttgattg |
11773904 |
T |
 |
| Q |
116 |
caatttcacaattttatgataattcaatatttcacacccttttccacattcacaaattttggagcattcaagtttattttagttgcaagattggtttttc |
215 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11773905 |
caatttcacaatttcatgataattcaatatttcacacccttttccacattcacaaattttggagcattcaagtttattttagttgcaagattggtttttc |
11774004 |
T |
 |
| Q |
216 |
actctatag |
224 |
Q |
| |
|
||||||||| |
|
|
| T |
11774005 |
actctatag |
11774013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University