View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20567_high_11 (Length: 208)
Name: NF20567_high_11
Description: NF20567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20567_high_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 118; Significance: 2e-60; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 55 - 192
Target Start/End: Complemental strand, 29252762 - 29252625
Alignment:
| Q |
55 |
atgatattatactggttcactatcaaccaatcgagtctacccctaacaaagtgactgacttttctttcccttgagatgaacttaattcactaactaagca |
154 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
29252762 |
atgatattatactggttcactatcaaccaatcgagtctacccctaacaaagtgactgacttttccttcccttgagatgaacttaattcactaactaaaca |
29252663 |
T |
|
| Q |
155 |
ttctttgctatgtctgtgagtatttatatggtgcctct |
192 |
Q |
| |
|
|||||||||||||||||||| || ||||||||||||| |
|
|
| T |
29252662 |
ttctttgctatgtctgtgagctttgatatggtgcctct |
29252625 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University