View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20567_high_12 (Length: 206)
Name: NF20567_high_12
Description: NF20567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20567_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 165; Significance: 2e-88; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 21 - 202
Target Start/End: Complemental strand, 28251479 - 28251294
Alignment:
| Q |
21 |
tgcaattcattgtccagctaactcactcataaatttcattctctttgcttaacttctcat----tcaattccagtccacataccaaaaccaatcatacaa |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
28251479 |
tgcaattcattgtccagctaactcactcataaatttcattctctttgcttaacttctcatatattcaattccagtccacataccaaaaccaatcatacaa |
28251380 |
T |
 |
| Q |
117 |
gttcatggcggctaatcctaatagactctctcttgccatggagagaactggccaatggtacacaacacactaaactcgactctatt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
28251379 |
gttcatggcggctaatcctaatagactctctcttgccatggagagaactggccaatggtacacaacacactaaactcaactctatt |
28251294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 176
Target Start/End: Complemental strand, 32181057 - 32181009
Alignment:
| Q |
128 |
ctaatcctaatagactctctcttgccatggagagaactggccaatggta |
176 |
Q |
| |
|
||||||| | ||||||||| ||||||||||||||||| || |||||||| |
|
|
| T |
32181057 |
ctaatccaagtagactctcccttgccatggagagaacaggacaatggta |
32181009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University