View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20567_high_3 (Length: 250)
Name: NF20567_high_3
Description: NF20567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20567_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 247
Target Start/End: Complemental strand, 16560591 - 16560356
Alignment:
| Q |
13 |
aatatgcacttcattatttcttatatcttaaagagaagacaattgttgcgcagacaagattatttctcgagggatctaaagtaatggttttgtttggtgg |
112 |
Q |
| |
|
||||||||||||||||||||| ||||||| | ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
16560591 |
aatatgcacttcattatttctcatatcttga-gagaagacaattgttgcgcagacaagattatttctcgtgggatctaaagtaatggttttgtttggtgg |
16560493 |
T |
|
| Q |
113 |
attcaatctcttc--gtgttttagattttgttaaccgaaataggtcggagcttccaggattatcatttatgttgatgtttttcaagggcttgaacttcta |
210 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16560492 |
attcaatctcttcttgtgttttagattttgttaaccaaaataggtcggagcttccaggattatcatttatgttgatgtttttcaagggcttgaacttcta |
16560393 |
T |
|
| Q |
211 |
tttactatgcaatatctttttcttcgccaatgtttta |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
16560392 |
tttactatgcaatatctttttcttcgccaatatttta |
16560356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University