View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20567_high_5 (Length: 239)
Name: NF20567_high_5
Description: NF20567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20567_high_5 |
 |  |
|
| [»] scaffold0252 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr8 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 4566953 - 4567176
Alignment:
| Q |
1 |
ctattttaagtaatgatatgaattaagtttacgttgatnnnnnnnnn-tctcaaatatacttgtcgaggataagaaactttaggccctataatcttaa-a |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || | |||||| ||||||||||||||||||||||||||||||| || ||||||| | |
|
|
| T |
4566953 |
ctattttaagtaatgatatgaattaagtttactttcgtaaaaaaaaaatctcaattatacttgtcgaggataagaaactttaggccataggatcttaaca |
4567052 |
T |
 |
| Q |
99 |
tataatatgataacataatacctaatcaacctaatctgtgaagacatgaaatattaatcaaaataagttgtaggtccattagttacgtcaggtgcatgtg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4567053 |
tataatatgataacataatacctaatcaacctaatctgtgaagacatgaaatattaatcaaaataagttgtaggtccattagttacgtcaggtgcatgtg |
4567152 |
T |
 |
| Q |
199 |
aaactttccagatataaagatgat |
222 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
4567153 |
aaactttccagatataaagatgat |
4567176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0252 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0252
Description:
Target: scaffold0252; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 2 - 32
Target Start/End: Original strand, 13448 - 13478
Alignment:
| Q |
2 |
tattttaagtaatgatatgaattaagtttac |
32 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13448 |
tattttaagtaatgatatgaattaagtttac |
13478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University