View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20567_low_11 (Length: 222)
Name: NF20567_low_11
Description: NF20567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20567_low_11 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 186; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 16 - 213
Target Start/End: Original strand, 25895010 - 25895207
Alignment:
| Q |
16 |
gttttaaatcctcataactgaaaatttatataccaaattagttatttggcctccgtagtccacataaaaatttactgtcaacaaatattagcaagctggc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25895010 |
gttttaaatcctcataactgaaaatttatataccaaattagttatttggcctccgtagtccacataaaaatttactgtcaacaaatattagcaagctggc |
25895109 |
T |
 |
| Q |
116 |
ttacgcagtataaggagaaagcggctgttttgccactggtttcggttgttctgtttctttctgaggagtaatgctaggtacttctgccacaggttctg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
25895110 |
ttacgcagtataaggagaaagcggctgttttgccactagtttcggttgttctgtttctttctgaggagtgatgctaggtacttctgccactggttctg |
25895207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 25895194 - 25895245
Alignment:
| Q |
146 |
tgccactggtttcggttgttctgtttctttctgaggagtaatgctaggtact |
197 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| | ||||||||||||| |
|
|
| T |
25895194 |
tgccactggttctggttgttctgtttctttctgaggggcaatgctaggtact |
25895245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University