View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20567_low_3 (Length: 260)
Name: NF20567_low_3
Description: NF20567
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20567_low_3 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 11 - 260
Target Start/End: Complemental strand, 23523489 - 23523237
Alignment:
| Q |
11 |
taatactatatcatgtatgaaaaattgacatgttattattaccaagcttaatttataataaatagactcttcataaattaaataaccaaaattggttatt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23523489 |
taatactatatcatgtatgaaaaattgacatgttattattaccaagcttaatttataataaatagactcttcataaattaaataaccaaaattggttatt |
23523390 |
T |
|
| Q |
111 |
ttagagatgaagatccaaactaacatggtcgttacgtttagagtcataaacgtaacgattatgcgaagcagaagaa---gaaggtactccttgtccacta |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23523389 |
ttagagatgaagatccaaactaacatggtcgttacgtttagagtcataaacgtaacgattatgcgaagcagaagaagaagaaggtactccttgtccacta |
23523290 |
T |
|
| Q |
208 |
tgccacaaatttgatctttcctcagaagcaagcaaaggtaaaggacgttcatg |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23523289 |
tgccacaaatttgatctttcctcagaagcaagcaaaggtaaaggacgttcatg |
23523237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University