View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20568_high_16 (Length: 254)
Name: NF20568_high_16
Description: NF20568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20568_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 2e-92; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 31 - 210
Target Start/End: Original strand, 39664895 - 39665074
Alignment:
| Q |
31 |
accaataataacacggctcaaaaaatagattatggggtatatttcaaactcacctgataatcctgtttcagttagataatcctggcttaacttgtgtgat |
130 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39664895 |
accaataataacacggctcaaaaaatagattatggggtatatttcaaactcacctgataatcctgtttcggttagataatcctggcttaacttgtgtgat |
39664994 |
T |
 |
| Q |
131 |
ttttgttttagagcatcgcagagaattcatggttgttattatttgtgtgaataaaattagctttactccttttgaataaa |
210 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39664995 |
ttttgttttagagcatcgcagagaattcgtggttgttattatttgtgtgaataaaattagctttactccttttgaataaa |
39665074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 208 - 254
Target Start/End: Original strand, 39670031 - 39670077
Alignment:
| Q |
208 |
aaatcttggaggcatgaccctgataataataattttgcattgagatt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39670031 |
aaatcttggaggcatgaccctgataataataattttgcattgagatt |
39670077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 120 - 154
Target Start/End: Original strand, 39658273 - 39658307
Alignment:
| Q |
120 |
acttgtgtgatttttgttttagagcatcgcagaga |
154 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||| |
|
|
| T |
39658273 |
acttgtgtgatttttgttttagagcatggcagaga |
39658307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University