View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20568_low_15 (Length: 270)
Name: NF20568_low_15
Description: NF20568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20568_low_15 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 16 - 254
Target Start/End: Complemental strand, 18997251 - 18997019
Alignment:
| Q |
16 |
gaagcaactcacacaatttccttcgcttccgttttctctccctctagatcactctccctttctctcttgtttattgagcttttttgcaaagaaccaagtg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18997251 |
gaagcaactcacacaatttccttcgcttccgttttctctccctctagatcactctccctttctctcttgtttattgagcttttttgcaaagaaccaagtg |
18997152 |
T |
 |
| Q |
116 |
ggttgnnnnnnnnnnnnnnnnnnnnnccaaaacatattctctccaagtgaagaagttctcatatttataggcattcttgctaccgctttaaccaattgga |
215 |
Q |
| |
|
||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
18997151 |
ggttgtttttttttttcttc------ccaaaacatattctctccaagggaagaagttctcatatttataggcattcttgccaccgctttaaccaattgga |
18997058 |
T |
 |
| Q |
216 |
aaggtttcctctctcatggttttccttaacctcctttgc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18997057 |
aaggtttcctctctcatggttttccttaacctcctttgc |
18997019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 57 - 115
Target Start/End: Original strand, 23582 - 23640
Alignment:
| Q |
57 |
ctctagatcactctccctttctctcttgtttattgagcttttttgcaaagaaccaagtg |
115 |
Q |
| |
|
||||||||||||||| ||||| ||||||||||||||| | |||||||||||| |||||| |
|
|
| T |
23582 |
ctctagatcactctctctttccctcttgtttattgaggtcttttgcaaagaatcaagtg |
23640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University