View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20568_low_25 (Length: 217)

Name: NF20568_low_25
Description: NF20568
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20568_low_25
NF20568_low_25
[»] chr5 (1 HSPs)
chr5 (1-174)||(4336887-4337060)


Alignment Details
Target: chr5 (Bit Score: 153; Significance: 3e-81; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 174
Target Start/End: Complemental strand, 4337060 - 4336887
Alignment:
1 ggtcccatctttatcattgtcggaatcttcgccgaaaaggtccttccccgtgaaatccattttttcacggtctcttatgttgttgttatgtgatgtcagt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4337060 ggtcccatctttatcattgtcggaatcttcgccgaaaaggtccttccccgtgaaatccattttttcacggtctcttatgttgttgttatgtgatgtcagt 4336961  T
101 gttatttcgtcaacaataaaacctttgnnnnnnncttttacgctgttacactgttgtgttcgtgtaccttaaag 174  Q
    |||||||||||||||||||||||||||       ||||||||||||||||||||||||||||||||||||||||    
4336960 gttatttcgtcaacaataaaacctttgtttttttcttttacgctgttacactgttgtgttcgtgtaccttaaag 4336887  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University