View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_high_16 (Length: 368)
Name: NF20569_high_16
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_high_16 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 206 - 352
Target Start/End: Complemental strand, 10368897 - 10368751
Alignment:
| Q |
206 |
atctctttaatatacatgcttcttgagattaatttgattggatttggagtggttttattttaatcttaactttataagatacacgaaaaattagttgaca |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10368897 |
atctctttaatatacatgcttcttgagattaatttgattggatttggagtggttttattttaatcttaactttataagatacacgaaaaattagttgaca |
10368798 |
T |
 |
| Q |
306 |
gtaacatgtttcaatccgggaaaattaagtctgaaggaactactttg |
352 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10368797 |
gtaacatgtttcaattcgggaaaattaagtctgaaggaactactttg |
10368751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 138; E-Value: 5e-72
Query Start/End: Original strand, 1 - 138
Target Start/End: Complemental strand, 10369102 - 10368965
Alignment:
| Q |
1 |
gaaagtttctcagttgaaggcacttctggaattaactgaaaaacatgagaaagagattgttgaagctctttactctgacttatcaaaatctgaagctgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10369102 |
gaaagtttctcagttgaaggcacttctggaattaactgaaaaacatgagaaagagattgttgaagctctttactctgacttatcaaaatctgaagctgaa |
10369003 |
T |
 |
| Q |
101 |
tccttcatccaagaggtactcaatttctcacagtacta |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10369002 |
tccttcatccaagaggtactcaatttctcacagtacta |
10368965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University