View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_high_24 (Length: 264)
Name: NF20569_high_24
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_high_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 10 - 246
Target Start/End: Complemental strand, 1250968 - 1250732
Alignment:
| Q |
10 |
aagaatatggtgcatgaaaatcaactcaatttctgtttcttttaattgcttaggttccaattcttggtctttttcactcttttggcaattagtaggggag |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1250968 |
aagaaaatggtgcatgaaaatcaactcaatttctgtttcttttaattgcttaggttccaattcttggtctttttcactcttttggcaattagtaggggag |
1250869 |
T |
 |
| Q |
110 |
gaatgctatatggtacgaagtgtcacgaatttagaatcatcatctcagggtggatgaagattcatagccttttgtataaataacatttgtactatcaatc |
209 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1250868 |
gaatgctatatggtacaaagtgtcacgaatttagaatcatcatctcagggtggatgaagattcatagccttttgtataaataacatttgtactatcaatc |
1250769 |
T |
 |
| Q |
210 |
attttaattgtttaatattaattagtagggttactca |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1250768 |
attttaattgtttaatattaattagtagggttactca |
1250732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University