View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20569_high_37 (Length: 243)

Name: NF20569_high_37
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20569_high_37
NF20569_high_37
[»] chr4 (1 HSPs)
chr4 (2-243)||(6119491-6119732)


Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 2 - 243
Target Start/End: Original strand, 6119491 - 6119732
Alignment:
2 gaaatgaaccggacgagcaccatgtgtcggtgaggatttttaagggacggagttggttttttatggggtcgaagaggactgaatgcgcgtaacaatccgg 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||    
6119491 gaaatgaaccggacgagcaccatgtgtcggtgaggatttttaagggacggagttggttttttatggggtcgaagaggactgaatgggcgtaacaatccgg 6119590  T
102 tttggttttggtgaaccggcaatggttttttgggaggagtttacgggttggaccgatgttggttcggtctaagaggataacggtgttgaagcgtgttact 201  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
6119591 tttggttttggtgaaccggcaatggttttttgggaggagtttacgggttggaccgatgttggttcggtctaagaggataacggtgttgaagcgtgttact 6119690  T
202 gttgtgtgcattgaggctatacctgcgttttggactagaagc 243  Q
    ||||||||||||||||||||||||||||||||||||||||||    
6119691 gttgtgtgcattgaggctatacctgcgttttggactagaagc 6119732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University