View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_high_37 (Length: 243)
Name: NF20569_high_37
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_high_37 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 238; Significance: 1e-132; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 238; E-Value: 1e-132
Query Start/End: Original strand, 2 - 243
Target Start/End: Original strand, 6119491 - 6119732
Alignment:
| Q |
2 |
gaaatgaaccggacgagcaccatgtgtcggtgaggatttttaagggacggagttggttttttatggggtcgaagaggactgaatgcgcgtaacaatccgg |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
6119491 |
gaaatgaaccggacgagcaccatgtgtcggtgaggatttttaagggacggagttggttttttatggggtcgaagaggactgaatgggcgtaacaatccgg |
6119590 |
T |
 |
| Q |
102 |
tttggttttggtgaaccggcaatggttttttgggaggagtttacgggttggaccgatgttggttcggtctaagaggataacggtgttgaagcgtgttact |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6119591 |
tttggttttggtgaaccggcaatggttttttgggaggagtttacgggttggaccgatgttggttcggtctaagaggataacggtgttgaagcgtgttact |
6119690 |
T |
 |
| Q |
202 |
gttgtgtgcattgaggctatacctgcgttttggactagaagc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6119691 |
gttgtgtgcattgaggctatacctgcgttttggactagaagc |
6119732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University