View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_high_41 (Length: 233)
Name: NF20569_high_41
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_high_41 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 41 - 218
Target Start/End: Original strand, 29997419 - 29997596
Alignment:
| Q |
41 |
cctacagtagctacatctagtcctttctcactgaaaaatttcttcactaaaaacaaactgattataaagtctaaaagggtatacttatttcaaatgacta |
140 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
29997419 |
cctatagtagctacatctagtcctttctcactgaaaaatttcttcactaaaaacaaactgattataaagtctaaaagggtatatttatttcaaatgacta |
29997518 |
T |
|
| Q |
141 |
taccattagcagtctaaaaatgacttacaatatatacttgagcctttgaggaacaagaaaacccacccgagatcaaac |
218 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29997519 |
taccactagcagtctaaaaatgacttacaatatatacttgagcttttgaggaacaagaaaacccacccgagatcaaac |
29997596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University