View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20569_high_42 (Length: 229)

Name: NF20569_high_42
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20569_high_42
NF20569_high_42
[»] chr7 (1 HSPs)
chr7 (13-210)||(3659884-3660093)


Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 3660093 - 3659884
Alignment:
13 gagaagaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaatgagg 112  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3660093 gagaagaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaatgagg 3659994  T
113 agagcgttca------------tgattatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaatggtgtctttgttcaaag 200  Q
    ||||||||||            ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3659993 agagcgttcatgatgatgatgatgattatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaatggtgtctttgttcaaag 3659894  T
201 gcaagtaatt 210  Q
    ||||||||||    
3659893 gcaagtaatt 3659884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University