View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_high_8 (Length: 445)
Name: NF20569_high_8
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_high_8 |
 |  |
|
| [»] chr8 (49 HSPs) |
 |  |
|
| [»] chr4 (47 HSPs) |
 |  |
|
| [»] chr1 (43 HSPs) |
 |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |
|
| [»] scaffold0121 (1 HSPs) |
 |  |
|
| [»] scaffold0100 (1 HSPs) |
 |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |
|
| [»] scaffold0555 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (1 HSPs) |
 |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |
|
| [»] scaffold0014 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 315; Significance: 1e-177; HSPs: 37)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 27 - 401
Target Start/End: Original strand, 32515444 - 32515817
Alignment:
| Q |
27 |
ttctctccttccagataactcaagaagtcgaaaaccaaatcataaacatgaaagagcatcgcgatcttgcaagacctgaagctgaaccaagctgaaggaa |
126 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
32515444 |
ttctctccttccagataacccaagaagtcgcaaaccaaatcataaacatgaaagagcatcgcgatcttgcaagacctgaagccgaaccaaactgaaggaa |
32515543 |
T |
 |
| Q |
127 |
atgatcctctgtgtttgacggcaaagctgtataaacatgtaaccaattccgaattaaatgccaaagttgagcaaaaacaccgcaatttaagaatagatat |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||| ||||||||||||||||| | |
|
|
| T |
32515544 |
atgatcctctgtgtttgacggcaaagctgtataaacatgtaaccaattccgaactaaatgccaaagctgagcaaaaacactgcaatttaagaatagatgt |
32515643 |
T |
 |
| Q |
227 |
tcatttgtctcctgcacaccacacccacctacacacatttgatcctcatactgaattatcccccgacgaaataaattaaccttaataggtagtctattcc |
326 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
32515644 |
tcatttgtctcctgcacaccaca-ccacctacacacatttgatcctcatactgaattatcccccaacgaaataaattaaccttagtagatagtctattcc |
32515742 |
T |
 |
| Q |
327 |
aaaagagccgccaagcaaaagatcaagaccttaagcggtgtaatactaacttaattgaaatcagtttgattaaat |
401 |
Q |
| |
|
||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32515743 |
aaaagggccgtcaagcaaaagatcaagaccttaagcggtgtaatactaacttaattgaaatcagtttgattaaat |
32515817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 21 - 221
Target Start/End: Complemental strand, 16818398 - 16818198
Alignment:
| Q |
21 |
tgttgtttctctccttccagataactcaagaagtcgaaaaccaaatcataaacatgaaagagcatcgcgatcttgcaagacctgaagctgaaccaagctg |
120 |
Q |
| |
|
|||||||||| | |||||||||||| | |||||||| |||||||||||||||||| |||||||| |||||||||||| ||| ||||| || |||| ||| |
|
|
| T |
16818398 |
tgttgtttcttttcttccagataaccctagaagtcgcaaaccaaatcataaacattaaagagcaccgcgatcttgcataaccagaagccgatccaaactg |
16818299 |
T |
 |
| Q |
121 |
aaggaaatgatcctctgtgtttgacggcaaagctgtataaacatgtaaccaattccgaattaaatgccaaagttgagcaaaaacaccgcaatttaagaat |
220 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||||| | |||||||||||||| || |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
16818298 |
aaggaagtgatcctctgtatttgacggcaaagctgtataaacctttaaccaattccgaaccaattgccaaagctgagcaaaaacaccgcaatttaagaat |
16818199 |
T |
 |
| Q |
221 |
a |
221 |
Q |
| |
|
| |
|
|
| T |
16818198 |
a |
16818198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 2228971 - 2229003
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
2228971 |
aatccccgtgagcttagctcagttggtagggat |
2229003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 37300173 - 37300141
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
37300173 |
aatccccgtgagcttagctcagttggtagggat |
37300141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 42443685 - 42443717
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
42443685 |
aatccccgtgagcttagctcagttggtagggat |
42443717 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 47999776 - 47999808
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
47999776 |
aatccccgtgagcttagctcagttggtagggat |
47999808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 2681093 - 2681124
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2681093 |
atccccgtgagcttagctcagttggtagggat |
2681124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 5990218 - 5990187
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
5990218 |
atccccgtgagcttagctcagttggtagggat |
5990187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 9877340 - 9877309
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9877340 |
atccccgtgagcttagctcagttggtagggat |
9877309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 10244962 - 10244931
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10244962 |
atccccgtgagcttagctcagttggtagggat |
10244931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 12640662 - 12640631
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12640662 |
atccccgtgagcttagctcagttggtagggat |
12640631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 15238886 - 15238917
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15238886 |
atccccgtgagcttagctcagttggtagggat |
15238917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 19753041 - 19753010
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19753041 |
atccccgtgagcttagctcagttggtagggat |
19753010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 23102631 - 23102600
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23102631 |
atccccgtgagcttagctcagttggtagggat |
23102600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 25833552 - 25833583
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25833552 |
atccccgtgagcttagctcagttggtagggat |
25833583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 29617402 - 29617433
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29617402 |
atccccgtgagcttagctcagttggtagggat |
29617433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 32074468 - 32074437
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32074468 |
atccccgtgagcttagctcagttggtagggat |
32074437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 35815835 - 35815866
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35815835 |
atccccgtgagcttagctcagttggtagggat |
35815866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 35950125 - 35950156
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35950125 |
atccccgtgagcttagctcagttggtagggat |
35950156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 36389739 - 36389708
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36389739 |
atccccgtgagcttagctcagttggtagggat |
36389708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 36469778 - 36469747
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36469778 |
atccccgtgagcttagctcagttggtagggat |
36469747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 410 - 445
Target Start/End: Original strand, 41084032 - 41084067
Alignment:
| Q |
410 |
tggaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41084032 |
tggaatcgccgtgagcttagctcagttggtagggat |
41084067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 44616599 - 44616630
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44616599 |
atccccgtgagcttagctcagttggtagggat |
44616630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 47641042 - 47641073
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47641042 |
atccccgtgagcttagctcagttggtagggat |
47641073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 415 - 445
Target Start/End: Original strand, 5833037 - 5833067
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
5833037 |
tccccgtgagcttagctcagttggtagggat |
5833067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 415 - 445
Target Start/End: Complemental strand, 26816730 - 26816700
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
26816730 |
tccccgtgagcttagctcagttggtagggat |
26816700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 442
Target Start/End: Complemental strand, 24061402 - 24061374
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagg |
442 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24061402 |
atccccgtgagcttagctcagttggtagg |
24061374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Original strand, 24781030 - 24781058
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24781030 |
cccgtgagcttagctcagttggtagggat |
24781058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 27424835 - 27424867
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
27424835 |
aatccccgtgagcttagctcagttggaagggat |
27424867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 27510327 - 27510299
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27510327 |
cccgtgagcttagctcagttggtagggat |
27510299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 30806111 - 30806143
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
30806111 |
aatccccgtgagtttagctcagttggtagggat |
30806143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 31026215 - 31026247
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
31026215 |
aatccccgtgagcgtagctcagttggtagggat |
31026247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 31077977 - 31077945
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
31077977 |
aatccccgtgagcttaactcagttggtagggat |
31077945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 35683197 - 35683169
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35683197 |
cccgtgagcttagctcagttggtagggat |
35683169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 36174386 - 36174418
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
36174386 |
aatctccgtgagcttagctcagttggtagggat |
36174418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 36391974 - 36391946
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36391974 |
cccgtgagcttagctcagttggtagggat |
36391946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 46534822 - 46534790
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
46534822 |
aatccccatgagcttagctcagttggtagggat |
46534790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 232; Significance: 1e-128; HSPs: 35)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 21 - 364
Target Start/End: Original strand, 10342555 - 10342896
Alignment:
| Q |
21 |
tgttgtttctctccttccagataactcaagaagtcgaaaaccaaatcataaacatgaaagagcatcgcgatcttgcaagacctgaagctgaaccaagctg |
120 |
Q |
| |
|
||||||||||||| ||||||||||| ||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||| |
|
|
| T |
10342555 |
tgttgtttctctcattccagataacccaaaaagtcgcaaaccaaatcataaacatgaaagagcatcgcgatcttgcaagacctgaagccgaaccaaactg |
10342654 |
T |
 |
| Q |
121 |
aaggaaatgatcctctgtgtttgacggcaaagctgtataaacatgtaaccaattccgaattaaatgccaaagttgagcaaaaacaccgcaatttaagaat |
220 |
Q |
| |
|
|||||| |||||||||||||||||||| |||||| |||||| ||||||||| ||||||| ||||| ||||| ||||||||||||||||||||||| ||| |
|
|
| T |
10342655 |
aaggaa-tgatcctctgtgtttgacggaaaagctatataaatatgtaaccagttccgaaccaaatggcaaagctgagcaaaaacaccgcaatttaaaaat |
10342753 |
T |
 |
| Q |
221 |
agatattcatttgtctcctgcacaccacacccacctacacacatttgatcctcatactgaattatcccccgacgaaataaattaaccttaataggtagtc |
320 |
Q |
| |
|
|||| |||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |||| |||| |
|
|
| T |
10342754 |
agatgttcattagtctcctgcacaccacacccacctacacacatttgatcctcatattgaattatcccccgacgaaataaattagccttagtaggaagtc |
10342853 |
T |
 |
| Q |
321 |
tattccaaaagagccgccaagcaaaagatcaagaccttaagcgg |
364 |
Q |
| |
|
|||| | |||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
10342854 |
tatttcgaaagagccaccaagcaaaa-atcaagaccttaagcgg |
10342896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 115; E-Value: 3e-58
Query Start/End: Original strand, 70 - 212
Target Start/End: Original strand, 10343052 - 10343194
Alignment:
| Q |
70 |
aaacatgaaagagcatcgcgatcttgcaagacctgaagctgaaccaagctgaaggaaatgatcctctgtgtttgacggcaaagctgtataaacatgtaac |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
10343052 |
aaacatgaaagagcatcgcgatcttgcaagacctgaagccgaaccaaactgaaggaaatgatcctctgtgtttgacggcaaagttgtataaacatttaac |
10343151 |
T |
 |
| Q |
170 |
caattccgaattaaatgccaaagttgagcaaaaacaccgcaat |
212 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
10343152 |
caattccgaaccaaatgccaaagctgagcaaaaacaccgcaat |
10343194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 4408354 - 4408386
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4408354 |
aatccccgtgagcttagctcagttggtagggat |
4408386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 8857086 - 8857118
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8857086 |
aatccccgtgagcttagctcagttggtagggat |
8857118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 17441913 - 17441881
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17441913 |
aatccccgtgagcttagctcagttggtagggat |
17441881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 19953902 - 19953870
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
19953902 |
aatccccgtgagcttagctcagttggtagggat |
19953870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 607184 - 607215
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
607184 |
atccccgtgagcttagctcagttggtagggat |
607215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 1968993 - 1969024
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1968993 |
atccccgtgagcttagctcagttggtagggat |
1969024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 3794246 - 3794215
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3794246 |
atccccgtgagcttagctcagttggtagggat |
3794215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 7177292 - 7177323
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7177292 |
atccccgtgagcttagctcagttggtagggat |
7177323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 7207841 - 7207872
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7207841 |
atccccgtgagcttagctcagttggtagggat |
7207872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 7545326 - 7545357
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7545326 |
atccccgtgagcttagctcagttggtagggat |
7545357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 7865428 - 7865397
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7865428 |
atccccgtgagcttagctcagttggtagggat |
7865397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 9246455 - 9246424
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9246455 |
atccccgtgagcttagctcagttggtagggat |
9246424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 9372274 - 9372243
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9372274 |
atccccgtgagcttagctcagttggtagggat |
9372243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 9435623 - 9435654
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9435623 |
atccccgtgagcttagctcagttggtagggat |
9435654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 10934596 - 10934627
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10934596 |
atccccgtgagcttagctcagttggtagggat |
10934627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 15091445 - 15091476
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15091445 |
atccccgtgagcttagctcagttggtagggat |
15091476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 22574867 - 22574898
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22574867 |
atccccgtgagcttagctcagttggtagggat |
22574898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 30885643 - 30885612
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30885643 |
atccccgtgagcttagctcagttggtagggat |
30885612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 33573814 - 33573845
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33573814 |
atccccgtgagcttagctcagttggtagggat |
33573845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 445
Target Start/End: Original strand, 2251837 - 2251866
Alignment:
| Q |
416 |
ccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
2251837 |
ccccgtgagcttagctcagttggtagggat |
2251866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 8297622 - 8297655
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
8297622 |
gaatccccgtgagcttagctcaattggtagggat |
8297655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Complemental strand, 19892351 - 19892318
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
19892351 |
gaatccccgtgagcttagttcagttggtagggat |
19892318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 22997331 - 22997364
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
22997331 |
gaatctccgtgagcttagctcagttggtagggat |
22997364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Complemental strand, 23791070 - 23791037
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
23791070 |
gaatctccgtgagcttagctcagttggtagggat |
23791037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Original strand, 3196619 - 3196647
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
3196619 |
cccgtgagcttagctcagttggtagggat |
3196647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 3640510 - 3640542
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
3640510 |
aatcctcgtgagcttagctcagttggtagggat |
3640542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 4869768 - 4869740
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4869768 |
cccgtgagcttagctcagttggtagggat |
4869740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 5052147 - 5052115
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
5052147 |
aatccccgtgagcttagctcaattggtagggat |
5052115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Original strand, 8439675 - 8439703
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8439675 |
cccgtgagcttagctcagttggtagggat |
8439703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 21248528 - 21248560
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
21248528 |
aatccccgtaagcttagctcagttggtagggat |
21248560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 30391294 - 30391262
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
30391294 |
aatccccgtgagcttagctcagttgttagggat |
30391262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 30704956 - 30704988
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
30704956 |
aatccccgtgagcttagttcagttggtagggat |
30704988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 31705895 - 31705927
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
31705895 |
aatccccgtgagcttagctcagttggtatggat |
31705927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 82; Significance: 1e-38; HSPs: 49)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 21 - 221
Target Start/End: Complemental strand, 1780228 - 1780027
Alignment:
| Q |
21 |
tgttgtttctctccttccagataactcaagaagtcgaaaaccaaatcataaacatgaaagagcatcgcgatcttgcaagacctgaagctgaaccaagctg |
120 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||| ||| |||||||||||| |||||||| | |||||||||| | | ||||| || |||| ||| |
|
|
| T |
1780228 |
tgttgtttcttttcttccagataactcaagaagtcgcaaagtaaatcataaacaataaagagcaccacgatcttgcataagcagaagccgagccaaactg |
1780129 |
T |
 |
| Q |
121 |
aaggaaatgatcctctgtgtttgacggcaaagctgtataaacatgtaaccaa-ttccgaattaaatgccaaagttgagcaaaaacaccgcaatttaagaa |
219 |
Q |
| |
|
|||||| ||||||||||| ||||||| ||||||||||||||| ||||||| ||| ||| || || ||||| |||||||||||||||||||||||||| |
|
|
| T |
1780128 |
aaggaagtgatcctctgtatttgacgacaaagctgtataaacccttaaccaatttctgaaccaattgtcaaagctgagcaaaaacaccgcaatttaagaa |
1780029 |
T |
 |
| Q |
220 |
ta |
221 |
Q |
| |
|
|| |
|
|
| T |
1780028 |
ta |
1780027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 266 - 346
Target Start/End: Complemental strand, 16239055 - 16238975
Alignment:
| Q |
266 |
tgatcctcatactgaattatcccccgacgaaataaattaaccttaataggtagtctattccaaaagagccgccaagcaaaa |
346 |
Q |
| |
|
||||| ||||||||||| |||||||| | |||||||||| |||| ||||| | |||||||| |||||| |||||| ||||| |
|
|
| T |
16239055 |
tgatcttcatactgaatgatcccccgtctaaataaattagccttcataggcaatctattccgaaagaggcgccaaccaaaa |
16238975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 7920315 - 7920348
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7920315 |
gaatccccgtgagcttagctcagttggtagggat |
7920348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 412 - 445
Target Start/End: Complemental strand, 45551884 - 45551851
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
45551884 |
gaatccccgtgagcttagctcagttggtagggat |
45551851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 3748676 - 3748644
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3748676 |
aatccccgtgagcttagctcagttggtagggat |
3748644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 7269951 - 7269983
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
7269951 |
aatccccgtgagcttagctcagttggtagggat |
7269983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 22502005 - 22501973
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
22502005 |
aatccccgtgagcttagctcagttggtagggat |
22501973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 31529032 - 31529000
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31529032 |
aatccccgtgagcttagctcagttggtagggat |
31529000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 39300380 - 39300412
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
39300380 |
aatccccgtgagcttagctcagttggtagggat |
39300412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 46796003 - 46795971
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46796003 |
aatccccgtgagcttagctcagttggtagggat |
46795971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 882386 - 882417
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
882386 |
atccccgtgagcttagctcagttggtagggat |
882417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 2522923 - 2522954
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2522923 |
atccccgtgagcttagctcagttggtagggat |
2522954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 11820001 - 11820032
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11820001 |
atccccgtgagcttagctcagttggtagggat |
11820032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 19550503 - 19550534
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19550503 |
atccccgtgagcttagctcagttggtagggat |
19550534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 19999864 - 19999895
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19999864 |
atccccgtgagcttagctcagttggtagggat |
19999895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 28550392 - 28550361
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
28550392 |
atccccgtgagcttagctcagttggtagggat |
28550361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 30555300 - 30555269
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30555300 |
atccccgtgagcttagctcagttggtagggat |
30555269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 31327574 - 31327543
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31327574 |
atccccgtgagcttagctcagttggtagggat |
31327543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 31327791 - 31327760
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
31327791 |
atccccgtgagcttagctcagttggtagggat |
31327760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 32256627 - 32256596
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32256627 |
atccccgtgagcttagctcagttggtagggat |
32256596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 33225421 - 33225390
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33225421 |
atccccgtgagcttagctcagttggtagggat |
33225390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 37488533 - 37488502
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37488533 |
atccccgtgagcttagctcagttggtagggat |
37488502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 37800684 - 37800653
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37800684 |
atccccgtgagcttagctcagttggtagggat |
37800653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 39966147 - 39966116
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39966147 |
atccccgtgagcttagctcagttggtagggat |
39966116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 40192153 - 40192184
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40192153 |
atccccgtgagcttagctcagttggtagggat |
40192184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 40548300 - 40548331
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40548300 |
atccccgtgagcttagctcagttggtagggat |
40548331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 40933904 - 40933873
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40933904 |
atccccgtgagcttagctcagttggtagggat |
40933873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 44652055 - 44652024
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44652055 |
atccccgtgagcttagctcagttggtagggat |
44652024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 45701341 - 45701372
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45701341 |
atccccgtgagcttagctcagttggtagggat |
45701372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 48739817 - 48739786
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48739817 |
atccccgtgagcttagctcagttggtagggat |
48739786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 50496887 - 50496856
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50496887 |
atccccgtgagcttagctcagttggtagggat |
50496856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 52410314 - 52410283
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52410314 |
atccccgtgagcttagctcagttggtagggat |
52410283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 52945892 - 52945923
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52945892 |
atccccgtgagcttagctcagttggtagggat |
52945923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 53163591 - 53163622
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53163591 |
atccccgtgagcttagctcagttggtagggat |
53163622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 53347363 - 53347332
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
53347363 |
atccccgtgagcttagctcagttggtagggat |
53347332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 445
Target Start/End: Complemental strand, 6920034 - 6920005
Alignment:
| Q |
416 |
ccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6920034 |
ccccgtgagcttagctcagttggtagggat |
6920005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 26 - 107
Target Start/End: Complemental strand, 16239294 - 16239213
Alignment:
| Q |
26 |
tttctctccttccagataactcaagaagtcgaaaaccaaatcataaacatgaaagagcatcgcgatcttgcaagacctgaag |
107 |
Q |
| |
|
||||| |||||||| || ||||||||| | | ||||||||| | | |||| ||||| || |||||| ||||||||||||||| |
|
|
| T |
16239294 |
tttctttccttccaaatgactcaagaacttgcaaaccaaatgagatacataaaagaacaccgcgattttgcaagacctgaag |
16239213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Original strand, 4139000 - 4139028
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4139000 |
cccgtgagcttagctcagttggtagggat |
4139028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 9176656 - 9176628
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9176656 |
cccgtgagcttagctcagttggtagggat |
9176628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 10176977 - 10176945
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
10176977 |
aatccccgtgaggttagctcagttggtagggat |
10176945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 13638319 - 13638287
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
13638319 |
aatccccgtgagcttagttcagttggtagggat |
13638287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 15975449 - 15975421
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15975449 |
cccgtgagcttagctcagttggtagggat |
15975421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 19996526 - 19996494
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
19996526 |
aatccccgtgagcgtagctcagttggtagggat |
19996494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 34102685 - 34102653
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
34102685 |
aatccccgtgagcttagttcagttggtagggat |
34102653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Original strand, 34757529 - 34757557
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34757529 |
cccgtgagcttagctcagttggtagggat |
34757557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 45871013 - 45871045
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
45871013 |
aatccccgtgagtttagctcagttggtagggat |
45871045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Original strand, 47098732 - 47098760
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
47098732 |
cccgtgagcttagctcagttggtagggat |
47098760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 52046455 - 52046427
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52046455 |
cccgtgagcttagctcagttggtagggat |
52046427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 53752774 - 53752742
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
53752774 |
aatccccgtgagcttaactcagttggtagggat |
53752742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 49; Significance: 7e-19; HSPs: 29)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 49; E-Value: 7e-19
Query Start/End: Original strand, 207 - 339
Target Start/End: Original strand, 31093167 - 31093298
Alignment:
| Q |
207 |
cgcaatttaagaatagatattcatttgtctcctgcacaccacacccacctacacacatttgatcctcatactgaattatcccccgacgaaataaattaac |
306 |
Q |
| |
|
||||||||||||||| || |||| |||||||||| ||||||||||| ||||||| |||||||||| | ||||| || || ||||||||||||||| | |
|
|
| T |
31093167 |
cgcaatttaagaataaatgaccattagtctcctgcattccacacccaccgacacacaattgatcctcaaattgaataat-ccacgacgaaataaattagc |
31093265 |
T |
 |
| Q |
307 |
cttaataggtagtctattccaaaagagccgcca |
339 |
Q |
| |
|
|||| |||| | |||||||| ||| |||||||| |
|
|
| T |
31093266 |
cttagtaggcaatctattccgaaaaagccgcca |
31093298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 43895908 - 43895941
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
43895908 |
gaatccccgtgagcttagctcagttggtagggat |
43895941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 4183172 - 4183204
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
4183172 |
aatccccgtgagcttagctcagttggtagggat |
4183204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 1260182 - 1260213
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1260182 |
atccccgtgagcttagctcagttggtagggat |
1260213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 3446727 - 3446758
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3446727 |
atccccgtgagcttagctcagttggtagggat |
3446758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 8250374 - 8250343
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8250374 |
atccccgtgagcttagctcagttggtagggat |
8250343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 11050830 - 11050799
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11050830 |
atccccgtgagcttagctcagttggtagggat |
11050799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 17078454 - 17078485
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17078454 |
atccccgtgagcttagctcagttggtagggat |
17078485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 18694782 - 18694813
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18694782 |
atccccgtgagcttagctcagttggtagggat |
18694813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 19281605 - 19281636
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19281605 |
atccccgtgagcttagctcagttggtagggat |
19281636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 19684070 - 19684101
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
19684070 |
atccccgtgagcttagctcagttggtagggat |
19684101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 22653717 - 22653686
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22653717 |
atccccgtgagcttagctcagttggtagggat |
22653686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 25857368 - 25857337
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25857368 |
atccccgtgagcttagctcagttggtagggat |
25857337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 27297172 - 27297203
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27297172 |
atccccgtgagcttagctcagttggtagggat |
27297203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 33229006 - 33228975
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33229006 |
atccccgtgagcttagctcagttggtagggat |
33228975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 38400307 - 38400338
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38400307 |
atccccgtgagcttagctcagttggtagggat |
38400338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 44822420 - 44822451
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44822420 |
atccccgtgagcttagctcagttggtagggat |
44822451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 44948593 - 44948624
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44948593 |
atccccgtgagcttagctcagttggtagggat |
44948624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Complemental strand, 10463270 - 10463241
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10463270 |
tccccgtgagcttagctcagttggtaggga |
10463241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 19958097 - 19958126
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19958097 |
tccccgtgagcttagctcagttggtaggga |
19958126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 20919608 - 20919637
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
20919608 |
tccccgtgagcttagctcagttggtaggga |
20919637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 23405194 - 23405223
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
23405194 |
tccccgtgagcttagctcagttggtaggga |
23405223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 445
Target Start/End: Original strand, 34613978 - 34614007
Alignment:
| Q |
416 |
ccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34613978 |
ccccgtgagcttagctcagttggtagggat |
34614007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 1844813 - 1844845
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
1844813 |
aatccccgtaagcttagctcagttggtagggat |
1844845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 442
Target Start/End: Original strand, 2289607 - 2289635
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagg |
442 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2289607 |
atccccgtgagcttagctcagttggtagg |
2289635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 2806571 - 2806543
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
2806571 |
cccgtgagcttagctcagttggtagggat |
2806543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 33233296 - 33233264
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
33233296 |
aatccccgtgagcttatctcagttggtagggat |
33233264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 38525627 - 38525595
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
38525627 |
aatccccgtgagcttagctcagttggtaaggat |
38525595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 44857308 - 44857276
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
44857308 |
aatcctcgtgagcttagctcagttggtagggat |
44857276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 45; Significance: 2e-16; HSPs: 40)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 198 - 338
Target Start/End: Original strand, 17828633 - 17828773
Alignment:
| Q |
198 |
caaaaacaccgcaatttaagaatagatattcatttgtctcctgcacaccacacccacctacacacatttgatcctcatactgaattatcccccgacgaaa |
297 |
Q |
| |
|
|||||| |||| |||||||||||| || ||||| ||||| |||| ||||||||||| |||||||||||| |||||| ||||| ||||||| |||||| |
|
|
| T |
17828633 |
caaaaaaaccgtaatttaagaataaatgatcattagtctcttgcattccacacccaccagcacacatttgatactcataatgaataatcccccaacgaaa |
17828732 |
T |
 |
| Q |
298 |
taaattaaccttaataggtagtctattccaaaagagccgcc |
338 |
Q |
| |
|
||| || ||| | |||| | |||||| | ||||||||||| |
|
|
| T |
17828733 |
taaggtagcctcagtaggcaatctatttcgaaagagccgcc |
17828773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 32706317 - 32706350
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
32706317 |
gaatccccgtgagcttagctcagttggtagggat |
32706350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 21749451 - 21749419
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21749451 |
aatccccgtgagcttagctcagttggtagggat |
21749419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 209 - 269
Target Start/End: Complemental strand, 24124649 - 24124589
Alignment:
| Q |
209 |
caatttaagaatagatattcatttgtctcctgcacaccacacccacctacacacatttgat |
269 |
Q |
| |
|
||||||||||||| || |||| ||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
24124649 |
caatttaagaataaatgaacattagtctcctgcactccacacccaccaacacacatttgat |
24124589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 1743124 - 1743155
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1743124 |
atccccgtgagcttagctcagttggtagggat |
1743155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 2848210 - 2848241
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2848210 |
atccccgtgagcttagctcagttggtagggat |
2848241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 4417758 - 4417727
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4417758 |
atccccgtgagcttagctcagttggtagggat |
4417727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 6518849 - 6518818
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6518849 |
atccccgtgagcttagctcagttggtagggat |
6518818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 9835030 - 9835061
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9835030 |
atccccgtgagcttagctcagttggtagggat |
9835061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 11897245 - 11897276
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
11897245 |
atccccgtgagcttagctcagttggtagggat |
11897276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 12463753 - 12463784
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12463753 |
atccccgtgagcttagctcagttggtagggat |
12463784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 12891554 - 12891585
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12891554 |
atccccgtgagcttagctcagttggtagggat |
12891585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 13622019 - 13621988
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
13622019 |
atccccgtgagcttagctcagttggtagggat |
13621988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 16603395 - 16603426
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
16603395 |
atccccgtgagcttagctcagttggtagggat |
16603426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 17545245 - 17545214
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17545245 |
atccccgtgagcttagctcagttggtagggat |
17545214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 21918049 - 21918080
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
21918049 |
atccccgtgagcttagctcagttggtagggat |
21918080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 25648158 - 25648127
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25648158 |
atccccgtgagcttagctcagttggtagggat |
25648127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 25729513 - 25729482
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25729513 |
atccccgtgagcttagctcagttggtagggat |
25729482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 27765254 - 27765285
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
27765254 |
atccccgtgagcttagctcagttggtagggat |
27765285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 29713449 - 29713418
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29713449 |
atccccgtgagcttagctcagttggtagggat |
29713418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 32505685 - 32505716
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32505685 |
atccccgtgagcttagctcagttggtagggat |
32505716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 41179876 - 41179845
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41179876 |
atccccgtgagcttagctcagttggtagggat |
41179845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 41477431 - 41477400
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41477431 |
atccccgtgagcttagctcagttggtagggat |
41477400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 42320314 - 42320345
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42320314 |
atccccgtgagcttagctcagttggtagggat |
42320345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 42916386 - 42916417
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42916386 |
atccccgtgagcttagctcagttggtagggat |
42916417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 444
Target Start/End: Original strand, 13956899 - 13956929
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
13956899 |
atccccgtgagcttagctcagttggtaggga |
13956929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 3198325 - 3198354
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3198325 |
tccccgtgagcttagctcagttggtaggga |
3198354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 4067980 - 4068009
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4067980 |
tccccgtgagcttagctcagttggtaggga |
4068009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 445
Target Start/End: Complemental strand, 4745947 - 4745918
Alignment:
| Q |
416 |
ccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
4745947 |
ccccgtgagcttagctcagttggtagggat |
4745918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 18815343 - 18815376
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |||| |
|
|
| T |
18815343 |
gaatccccgtgagcttagctcagttggtaaggat |
18815376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 445
Target Start/End: Complemental strand, 25472654 - 25472625
Alignment:
| Q |
416 |
ccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
25472654 |
ccccgtgagcttagctcagttggtagggat |
25472625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 2328588 - 2328620
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
2328588 |
aatccccgtgagcttagcttagttggtagggat |
2328620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 5966825 - 5966857
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
5966825 |
aatccccgtgagcgtagctcagttggtagggat |
5966857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 11795503 - 11795535
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
11795503 |
aatccctgtgagcttagctcagttggtagggat |
11795535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 18993535 - 18993503
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
18993535 |
aatccccgtgagcttagctcagttgatagggat |
18993503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 23292487 - 23292459
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
23292487 |
cccgtgagcttagctcagttggtagggat |
23292459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 24033073 - 24033105
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
24033073 |
aatccccgcgagcttagctcagttggtagggat |
24033105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Original strand, 35515512 - 35515540
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
35515512 |
cccgtgagcttagctcagttggtagggat |
35515540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 441
Target Start/End: Original strand, 40081874 - 40081902
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtag |
441 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40081874 |
aatccccgtgagcttagctcagttggtag |
40081902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 42525396 - 42525428
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
42525396 |
aatccccgtgagtttagctcagttggtagggat |
42525428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 34; Significance: 0.0000000006; HSPs: 49)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 11875881 - 11875914
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11875881 |
gaatccccgtgagcttagctcagttggtagggat |
11875914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 11890888 - 11890921
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11890888 |
gaatccccgtgagcttagctcagttggtagggat |
11890921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 16449120 - 16449153
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
16449120 |
gaatccccgtgagcttagctcagttggtagggat |
16449153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 10736948 - 10736916
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10736948 |
aatccccgtgagcttagctcagttggtagggat |
10736916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 26022243 - 26022275
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26022243 |
aatccccgtgagcttagctcagttggtagggat |
26022275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 28909461 - 28909493
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28909461 |
aatccccgtgagcttagctcagttggtagggat |
28909493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 34413058 - 34413090
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
34413058 |
aatccccgtgagcttagctcagttggtagggat |
34413090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 12298 - 12267
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
12298 |
atccccgtgagcttagctcagttggtagggat |
12267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 94584 - 94553
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
94584 |
atccccgtgagcttagctcagttggtagggat |
94553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 257536 - 257567
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
257536 |
atccccgtgagcttagctcagttggtagggat |
257567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 658384 - 658353
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
658384 |
atccccgtgagcttagctcagttggtagggat |
658353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 844120 - 844089
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
844120 |
atccccgtgagcttagctcagttggtagggat |
844089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 1937307 - 1937338
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1937307 |
atccccgtgagcttagctcagttggtagggat |
1937338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 2168520 - 2168489
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
2168520 |
atccccgtgagcttagctcagttggtagggat |
2168489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 6280477 - 6280508
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6280477 |
atccccgtgagcttagctcagttggtagggat |
6280508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 8265265 - 8265296
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8265265 |
atccccgtgagcttagctcagttggtagggat |
8265296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 9187296 - 9187265
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9187296 |
atccccgtgagcttagctcagttggtagggat |
9187265 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 17027953 - 17027922
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17027953 |
atccccgtgagcttagctcagttggtagggat |
17027922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 17558389 - 17558358
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17558389 |
atccccgtgagcttagctcagttggtagggat |
17558358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 17698519 - 17698550
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17698519 |
atccccgtgagcttagctcagttggtagggat |
17698550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 29514623 - 29514654
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29514623 |
atccccgtgagcttagctcagttggtagggat |
29514654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 29716857 - 29716888
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29716857 |
atccccgtgagcttagctcagttggtagggat |
29716888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 30972890 - 30972859
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30972890 |
atccccgtgagcttagctcagttggtagggat |
30972859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 32719680 - 32719649
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
32719680 |
atccccgtgagcttagctcagttggtagggat |
32719649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 33604245 - 33604214
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33604245 |
atccccgtgagcttagctcagttggtagggat |
33604214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 35939484 - 35939515
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35939484 |
atccccgtgagcttagctcagttggtagggat |
35939515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 38745352 - 38745321
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38745352 |
atccccgtgagcttagctcagttggtagggat |
38745321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 39362262 - 39362293
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39362262 |
atccccgtgagcttagctcagttggtagggat |
39362293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 41689879 - 41689910
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
41689879 |
atccccgtgagcttagctcagttggtagggat |
41689910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 43656033 - 43656064
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43656033 |
atccccgtgagcttagctcagttggtagggat |
43656064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 44340418 - 44340387
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44340418 |
atccccgtgagcttagctcagttggtagggat |
44340387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 444
Target Start/End: Complemental strand, 14876675 - 14876645
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
14876675 |
atccccgtgagcttagctcagttggtaggga |
14876645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 415 - 445
Target Start/End: Complemental strand, 23178963 - 23178933
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23178963 |
tccccgtgagcttagctcagttggtagggat |
23178933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 481009 - 481038
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
481009 |
tccccgtgagcttagctcagttggtaggga |
481038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 2792774 - 2792807
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
2792774 |
gaatccccgtgagcttagctcagttgatagggat |
2792807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Complemental strand, 13059249 - 13059220
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13059249 |
tccccgtgagcttagctcagttggtaggga |
13059220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 37717358 - 37717391
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
37717358 |
gaatccccgtgagcttaactcagttggtagggat |
37717391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Complemental strand, 43284041 - 43284008
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
43284041 |
gaatccccgtgagtttagctcagttggtagggat |
43284008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 2787155 - 2787123
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
2787155 |
aatctccgtgagcttagctcagttggtagggat |
2787123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 7797126 - 7797158
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
7797126 |
aatccccgtaagcttagctcagttggtagggat |
7797158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 7816399 - 7816431
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
7816399 |
aatccccgtaagcttagctcagttggtagggat |
7816431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 20540180 - 20540148
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
20540180 |
aatccccgtgagcttagctcagttgttagggat |
20540148 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 26280858 - 26280826
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
26280858 |
aatccccgtgagcttaactcagttggtagggat |
26280826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 34158727 - 34158699
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34158727 |
cccgtgagcttagctcagttggtagggat |
34158699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 34894365 - 34894397
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |
|
|
| T |
34894365 |
aatccccgtaagcttagctcagttggtagggat |
34894397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 36540283 - 36540315
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
36540283 |
aatccccgtgagcttaactcagttggtagggat |
36540315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 37092087 - 37092119
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
37092087 |
aatccccgtgagtttagctcagttggtagggat |
37092119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 38955268 - 38955236
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
38955268 |
aatccccgtgagcttaactcagttggtagggat |
38955236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 44673718 - 44673690
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44673718 |
cccgtgagcttagctcagttggtagggat |
44673690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 34; Significance: 0.0000000006; HSPs: 47)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 8965089 - 8965122
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
8965089 |
gaatccccgtgagcttagctcagttggtagggat |
8965122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 8433697 - 8433665
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8433697 |
aatccccgtgagcttagctcagttggtagggat |
8433665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 43147458 - 43147426
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43147458 |
aatccccgtgagcttagctcagttggtagggat |
43147426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 43207665 - 43207697
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
43207665 |
aatccccgtgagcttagctcagttggtagggat |
43207697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 46105531 - 46105563
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
46105531 |
aatccccgtgagcttagctcagttggtagggat |
46105563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 48798275 - 48798307
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
48798275 |
aatccccgtgagcttagctcagttggtagggat |
48798307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 3764081 - 3764050
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3764081 |
atccccgtgagcttagctcagttggtagggat |
3764050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 3847678 - 3847709
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3847678 |
atccccgtgagcttagctcagttggtagggat |
3847709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 6371111 - 6371142
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6371111 |
atccccgtgagcttagctcagttggtagggat |
6371142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 18360490 - 18360521
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18360490 |
atccccgtgagcttagctcagttggtagggat |
18360521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 23705226 - 23705195
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
23705226 |
atccccgtgagcttagctcagttggtagggat |
23705195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 24680159 - 24680128
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
24680159 |
atccccgtgagcttagctcagttggtagggat |
24680128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 26868346 - 26868377
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26868346 |
atccccgtgagcttagctcagttggtagggat |
26868377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 26919541 - 26919510
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26919541 |
atccccgtgagcttagctcagttggtagggat |
26919510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 35219573 - 35219542
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35219573 |
atccccgtgagcttagctcagttggtagggat |
35219542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 35465432 - 35465463
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35465432 |
atccccgtgagcttagctcagttggtagggat |
35465463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 36602439 - 36602408
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
36602439 |
atccccgtgagcttagctcagttggtagggat |
36602408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 37935858 - 37935889
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
37935858 |
atccccgtgagcttagctcagttggtagggat |
37935889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 39023172 - 39023203
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39023172 |
atccccgtgagcttagctcagttggtagggat |
39023203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 40051619 - 40051650
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40051619 |
atccccgtgagcttagctcagttggtagggat |
40051650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 43596892 - 43596923
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
43596892 |
atccccgtgagcttagctcagttggtagggat |
43596923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 44602482 - 44602513
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
44602482 |
atccccgtgagcttagctcagttggtagggat |
44602513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 45126129 - 45126160
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45126129 |
atccccgtgagcttagctcagttggtagggat |
45126160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 45849044 - 45849075
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45849044 |
atccccgtgagcttagctcagttggtagggat |
45849075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 46775103 - 46775072
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46775103 |
atccccgtgagcttagctcagttggtagggat |
46775072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 47934145 - 47934114
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
47934145 |
atccccgtgagcttagctcagttggtagggat |
47934114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 48569249 - 48569218
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48569249 |
atccccgtgagcttagctcagttggtagggat |
48569218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 48949650 - 48949681
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48949650 |
atccccgtgagcttagctcagttggtagggat |
48949681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 49901479 - 49901510
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
49901479 |
atccccgtgagcttagctcagttggtagggat |
49901510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 55251424 - 55251393
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
55251424 |
atccccgtgagcttagctcagttggtagggat |
55251393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 3161019 - 3161048
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
3161019 |
tccccgtgagcttagctcagttggtaggga |
3161048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Complemental strand, 33933811 - 33933782
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33933811 |
tccccgtgagcttagctcagttggtaggga |
33933782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 34353774 - 34353807
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
34353774 |
gaatctccgtgagcttagctcagttggtagggat |
34353807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 55055914 - 55055943
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
55055914 |
tccccgtgagcttagctcagttggtaggga |
55055943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 4958630 - 4958598
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
4958630 |
aatccccgtgagcttagttcagttggtagggat |
4958598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 9761111 - 9761143
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
9761111 |
aatccccgtgagcttacctcagttggtagggat |
9761143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 15604110 - 15604082
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
15604110 |
cccgtgagcttagctcagttggtagggat |
15604082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 22230504 - 22230476
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22230504 |
cccgtgagcttagctcagttggtagggat |
22230476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 22788744 - 22788716
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
22788744 |
cccgtgagcttagctcagttggtagggat |
22788716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 24997504 - 24997476
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24997504 |
cccgtgagcttagctcagttggtagggat |
24997476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 442
Target Start/End: Complemental strand, 29329896 - 29329868
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagg |
442 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
29329896 |
atccccgtgagcttagctcagttggtagg |
29329868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 30217595 - 30217627
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
30217595 |
aatctccgtgagcttagctcagttggtagggat |
30217627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 40994173 - 40994145
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
40994173 |
cccgtgagcttagctcagttggtagggat |
40994145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Original strand, 43978008 - 43978036
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
43978008 |
cccgtgagcttagctcagttggtagggat |
43978036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 50442815 - 50442783
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||| |||||||||||||||||||||||||| |
|
|
| T |
50442815 |
aatccctgtgagcttagctcagttggtagggat |
50442783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 414 - 442
Target Start/End: Complemental strand, 52483249 - 52483221
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagg |
442 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
52483249 |
atccccgtgagcttagctcagttggtagg |
52483221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 55536376 - 55536408
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
55536376 |
aatccccgtgagcttagctcagttggtaaggat |
55536408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000006; HSPs: 43)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 412 - 445
Target Start/End: Original strand, 42054328 - 42054361
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42054328 |
gaatccccgtgagcttagctcagttggtagggat |
42054361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 1836499 - 1836531
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
1836499 |
aatccccgtgagcttagctcagttggtagggat |
1836531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 10664868 - 10664836
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10664868 |
aatccccgtgagcttagctcagttggtagggat |
10664836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 17671484 - 17671452
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
17671484 |
aatccccgtgagcttagctcagttggtagggat |
17671452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 21265652 - 21265684
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
21265652 |
aatccccgtgagcttagctcagttggtagggat |
21265684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 32594247 - 32594279
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32594247 |
aatccccgtgagcttagctcagttggtagggat |
32594279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 33207201 - 33207233
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
33207201 |
aatccccgtgagcttagctcagttggtagggat |
33207233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 51050186 - 51050218
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51050186 |
aatccccgtgagcttagctcagttggtagggat |
51050218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 1151756 - 1151787
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1151756 |
atccccgtgagcttagctcagttggtagggat |
1151787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 1570265 - 1570234
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
1570265 |
atccccgtgagcttagctcagttggtagggat |
1570234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 3269616 - 3269647
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3269616 |
atccccgtgagcttagctcagttggtagggat |
3269647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 4482671 - 4482640
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4482671 |
atccccgtgagcttagctcagttggtagggat |
4482640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 6438137 - 6438106
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6438137 |
atccccgtgagcttagctcagttggtagggat |
6438106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 6702573 - 6702604
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6702573 |
atccccgtgagcttagctcagttggtagggat |
6702604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 6893310 - 6893279
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
6893310 |
atccccgtgagcttagctcagttggtagggat |
6893279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 7166300 - 7166269
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
7166300 |
atccccgtgagcttagctcagttggtagggat |
7166269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 8865851 - 8865882
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8865851 |
atccccgtgagcttagctcagttggtagggat |
8865882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 15819674 - 15819643
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
15819674 |
atccccgtgagcttagctcagttggtagggat |
15819643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 18216903 - 18216934
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
18216903 |
atccccgtgagcttagctcagttggtagggat |
18216934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 22563383 - 22563414
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
22563383 |
atccccgtgagcttagctcagttggtagggat |
22563414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 25999847 - 25999878
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
25999847 |
atccccgtgagcttagctcagttggtagggat |
25999878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 26584819 - 26584788
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
26584819 |
atccccgtgagcttagctcagttggtagggat |
26584788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 33254725 - 33254756
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33254725 |
atccccgtgagcttagctcagttggtagggat |
33254756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 33274897 - 33274928
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
33274897 |
atccccgtgagcttagctcagttggtagggat |
33274928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 35605696 - 35605665
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
35605696 |
atccccgtgagcttagctcagttggtagggat |
35605665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 40519617 - 40519586
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40519617 |
atccccgtgagcttagctcagttggtagggat |
40519586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 42490483 - 42490452
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
42490483 |
atccccgtgagcttagctcagttggtagggat |
42490452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 46965737 - 46965768
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46965737 |
atccccgtgagcttagctcagttggtagggat |
46965768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 48638529 - 48638560
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
48638529 |
atccccgtgagcttagctcagttggtagggat |
48638560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 50899583 - 50899552
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
50899583 |
atccccgtgagcttagctcagttggtagggat |
50899552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 21 - 79
Target Start/End: Complemental strand, 10448709 - 10448651
Alignment:
| Q |
21 |
tgttgtttctctccttccagataactcaagaagtcgaaaaccaaatcataaacatgaaa |
79 |
Q |
| |
|
|||| ||||| |||||||||| ||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
10448709 |
tgttatttctttccttccagagaacccaagaagtcgcaaaccaaatcaagaacatgaaa |
10448651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 414 - 444
Target Start/End: Complemental strand, 23933141 - 23933111
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
23933141 |
atccccgtgagcttagctcagttggtaggga |
23933111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 416 - 445
Target Start/End: Original strand, 16343027 - 16343056
Alignment:
| Q |
416 |
ccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
16343027 |
ccccgtgagcttagctcagttggtagggat |
16343056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 412 - 445
Target Start/End: Complemental strand, 16526252 - 16526219
Alignment:
| Q |
412 |
gaatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
16526252 |
gaatccccgtgagcttagctcaattggtagggat |
16526219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 33200036 - 33200065
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
33200036 |
tccccgtgagcttagctcagttggtaggga |
33200065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 6463110 - 6463078
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| |
|
|
| T |
6463110 |
aatccccatgagcttagctcagttggtagggat |
6463078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 9866254 - 9866226
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
9866254 |
cccgtgagcttagctcagttggtagggat |
9866226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Original strand, 24874971 - 24874999
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
24874971 |
cccgtgagcttagctcagttggtagggat |
24874999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 34058210 - 34058242
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
34058210 |
aatctccgtgagcttagctcagttggtagggat |
34058242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 416 - 444
Target Start/End: Complemental strand, 36666647 - 36666619
Alignment:
| Q |
416 |
ccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
36666647 |
ccccgtgagcttagctcagttggtaggga |
36666619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 37662631 - 37662599
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
37662631 |
aatcctcgtgagcttagctcagttggtagggat |
37662599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 40520826 - 40520858
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
40520826 |
aatccccgtgagtttagctcagttggtagggat |
40520858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 45333785 - 45333753
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
45333785 |
aatccccgtgagcttagctcagttggcagggat |
45333753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 8817 - 8849
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
8817 |
aatccccgtgagcttagctcagttggtagggat |
8849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 413 - 445
Target Start/End: Complemental strand, 10900 - 10868
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10900 |
aatccccgtgagcttagctcagttggtagggat |
10868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 93 - 62
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
93 |
atccccgtgagcttagctcagttggtagggat |
62 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 8963 - 8994
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8963 |
atccccgtgagcttagctcagttggtagggat |
8994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 4087 - 4056
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
4087 |
atccccgtgagcttagctcagttggtagggat |
4056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 17617 - 17648
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17617 |
atccccgtgagcttagctcagttggtagggat |
17648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 46523 - 46554
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
46523 |
atccccgtgagcttagctcagttggtagggat |
46554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0100 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0100
Description:
Target: scaffold0100; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 45881 - 45912
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
45881 |
atccccgtgagcttagctcagttggtagggat |
45912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Original strand, 59780 - 59811
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
59780 |
atccccgtgagcttagctcagttggtagggat |
59811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 266770 - 266739
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
266770 |
atccccgtgagcttagctcagttggtagggat |
266739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 414 - 445
Target Start/End: Complemental strand, 8898 - 8867
Alignment:
| Q |
414 |
atccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8898 |
atccccgtgagcttagctcagttggtagggat |
8867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0555 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0555
Description:
Target: scaffold0555; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 415 - 444
Target Start/End: Original strand, 9309 - 9338
Alignment:
| Q |
415 |
tccccgtgagcttagctcagttggtaggga |
444 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
9309 |
tccccgtgagcttagctcagttggtaggga |
9338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 413 - 445
Target Start/End: Original strand, 12455 - 12487
Alignment:
| Q |
413 |
aatccccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
12455 |
aatccccgtgagcgtagctcagttggtagggat |
12487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 930 - 902
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
930 |
cccgtgagcttagctcagttggtagggat |
902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 417 - 445
Target Start/End: Complemental strand, 12331 - 12303
Alignment:
| Q |
417 |
cccgtgagcttagctcagttggtagggat |
445 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
12331 |
cccgtgagcttagctcagttggtagggat |
12303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University