View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_low_10 (Length: 396)
Name: NF20569_low_10
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_low_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 183 - 380
Target Start/End: Original strand, 6266076 - 6266273
Alignment:
| Q |
183 |
atatctagaacaacttagtttgattgttataatgaagaatttggtttattgttctctcattaatttctaaaatttatgtatcgttagcttgttttctaac |
282 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
6266076 |
atatctagaagaacttagtttgattgttatgatgaagaatttggtttattgttctctcattgatttctaaaatttatgtatcgttagcgtgttttctaac |
6266175 |
T |
 |
| Q |
283 |
tcgctcaattaatgttgatctcaacttatgaatgaaaaaagtgtcaacttgtgatcaatttgattatacnnnnnnnactttagtatttaaatagaact |
380 |
Q |
| |
|
|| || |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6266176 |
tcacttaattaatgttgatctcaacttatgaatgaaaaaagtctcaacttgtgatcaatttgattatattttttttactttagtatttaaatagaact |
6266273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 116 - 148
Target Start/End: Complemental strand, 2600895 - 2600863
Alignment:
| Q |
116 |
gtagatggatgagattaaagacttaagatcttg |
148 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| |
|
|
| T |
2600895 |
gtagatggatgagattaaagacttaggatcttg |
2600863 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University