View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20569_low_10 (Length: 396)

Name: NF20569_low_10
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20569_low_10
NF20569_low_10
[»] chr1 (1 HSPs)
chr1 (183-380)||(6266076-6266273)
[»] chr3 (1 HSPs)
chr3 (116-148)||(2600863-2600895)


Alignment Details
Target: chr1 (Bit Score: 145; Significance: 3e-76; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 145; E-Value: 3e-76
Query Start/End: Original strand, 183 - 380
Target Start/End: Original strand, 6266076 - 6266273
Alignment:
183 atatctagaacaacttagtttgattgttataatgaagaatttggtttattgttctctcattaatttctaaaatttatgtatcgttagcttgttttctaac 282  Q
    |||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||    
6266076 atatctagaagaacttagtttgattgttatgatgaagaatttggtttattgttctctcattgatttctaaaatttatgtatcgttagcgtgttttctaac 6266175  T
283 tcgctcaattaatgttgatctcaacttatgaatgaaaaaagtgtcaacttgtgatcaatttgattatacnnnnnnnactttagtatttaaatagaact 380  Q
    || || |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||        ||||||||||||||||||||||    
6266176 tcacttaattaatgttgatctcaacttatgaatgaaaaaagtctcaacttgtgatcaatttgattatattttttttactttagtatttaaatagaact 6266273  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 116 - 148
Target Start/End: Complemental strand, 2600895 - 2600863
Alignment:
116 gtagatggatgagattaaagacttaagatcttg 148  Q
    ||||||||||||||||||||||||| |||||||    
2600895 gtagatggatgagattaaagacttaggatcttg 2600863  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University