View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_low_36 (Length: 243)
Name: NF20569_low_36
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_low_36 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 18 - 221
Target Start/End: Original strand, 16891450 - 16891653
Alignment:
| Q |
18 |
gtaactcttgttagaaacgagataggttgtagaaaaatgatccaattagttttgatgatattaaaataagttaggggaacaattttatctctaattttta |
117 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16891450 |
gtaactcttgttagaaacgagatgggttgtagaaaaatgatccaattagttttgatcatattaaaataagtcaggggaacaattttatctctaattttta |
16891549 |
T |
|
| Q |
118 |
tttgattatgcagataaaatatttatattaatttagaagtttcactatattatctcatgcatatggcaccactctatttgaaaacgatgatcagaatctc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16891550 |
tttgattatgcagataaaatatttatattaatttagaagtttcactatattatctcatgcatgtggcaccactctatttgaaaacgatgatcagaatctc |
16891649 |
T |
|
| Q |
218 |
gaat |
221 |
Q |
| |
|
|||| |
|
|
| T |
16891650 |
gaat |
16891653 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University