View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_low_42 (Length: 229)
Name: NF20569_low_42
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_low_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 13 - 210
Target Start/End: Complemental strand, 3660093 - 3659884
Alignment:
| Q |
13 |
gagaagaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaatgagg |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3660093 |
gagaagaagaagctgttgaagaatttgagggggagagttgagaagattagcaaattgtgtaaggtttatggagatgatgaggaaggtttagagaatgagg |
3659994 |
T |
 |
| Q |
113 |
agagcgttca------------tgattatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaatggtgtctttgttcaaag |
200 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3659993 |
agagcgttcatgatgatgatgatgattatgatgacgatggagtaactgatgttgtggtcgctagaagggatgggaacaaaaatggtgtctttgttcaaag |
3659894 |
T |
 |
| Q |
201 |
gcaagtaatt |
210 |
Q |
| |
|
|||||||||| |
|
|
| T |
3659893 |
gcaagtaatt |
3659884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University