View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_low_45 (Length: 218)
Name: NF20569_low_45
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_low_45 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 86 - 200
Target Start/End: Original strand, 2288644 - 2288758
Alignment:
| Q |
86 |
agttaaatttcataagtatgtcggtgagatacccatctttcaactgtttctgtaatctcatcaactctttcacctttgtatagttacttagtgaccacgt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2288644 |
agttaaatttcataagtatgtcggtgagataccaatctttcaactgtttctgtaatctcatcaactctttcacctttgtatagttacttagtgaccacgt |
2288743 |
T |
|
| Q |
186 |
gataaccagcgatat |
200 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
2288744 |
gataaccagcgatat |
2288758 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 154
Target Start/End: Original strand, 670605 - 670720
Alignment:
| Q |
40 |
aaacaagcccactttaaatagttcattcataataaaaatgaacgggagt--taaatttcataagtatgtcggtgagatacccatctttcaactgtttctg |
137 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||| |||| ||||| || ||||| | ||| || ||| | ||||| || |||||||| |||||| |
|
|
| T |
670605 |
aaacaaacccactttaaatagttcattcattataaaaacgaactggagtaatatatttcctttgtaggttggtaaaataccaat-tttcaactatttctg |
670703 |
T |
|
| Q |
138 |
taatctcatcaactctt |
154 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
670704 |
caatctcattaactctt |
670720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University