View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20569_low_45 (Length: 218)

Name: NF20569_low_45
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20569_low_45
NF20569_low_45
[»] chr1 (2 HSPs)
chr1 (86-200)||(2288644-2288758)
chr1 (40-154)||(670605-670720)


Alignment Details
Target: chr1 (Bit Score: 111; Significance: 3e-56; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 86 - 200
Target Start/End: Original strand, 2288644 - 2288758
Alignment:
86 agttaaatttcataagtatgtcggtgagatacccatctttcaactgtttctgtaatctcatcaactctttcacctttgtatagttacttagtgaccacgt 185  Q
    ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
2288644 agttaaatttcataagtatgtcggtgagataccaatctttcaactgtttctgtaatctcatcaactctttcacctttgtatagttacttagtgaccacgt 2288743  T
186 gataaccagcgatat 200  Q
    |||||||||||||||    
2288744 gataaccagcgatat 2288758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 40 - 154
Target Start/End: Original strand, 670605 - 670720
Alignment:
40 aaacaagcccactttaaatagttcattcataataaaaatgaacgggagt--taaatttcataagtatgtcggtgagatacccatctttcaactgtttctg 137  Q
    |||||| ||||||||||||||||||||||| ||||||| |||| |||||  || ||||| |  ||| || ||| | ||||| || |||||||| ||||||    
670605 aaacaaacccactttaaatagttcattcattataaaaacgaactggagtaatatatttcctttgtaggttggtaaaataccaat-tttcaactatttctg 670703  T
138 taatctcatcaactctt 154  Q
     |||||||| |||||||    
670704 caatctcattaactctt 670720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University