View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20569_low_46 (Length: 216)
Name: NF20569_low_46
Description: NF20569
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20569_low_46 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 204
Target Start/End: Complemental strand, 5986412 - 5986209
Alignment:
| Q |
1 |
aatgtattgtacttaatatttttctagaagcttcgatattaatttcgttgtgtataaatcttttgattcgatttgattgatgggatttatatattgtttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5986412 |
aatgtattgtacttaatatttttctagaagcttcgatattaatttcgttgtgtataaatcttttgattcgatttgattgatgggatttatatattgtttc |
5986313 |
T |
|
| Q |
101 |
ggaaactacggacgagtcgtcccttgattttctgcatctctttgctgtatttgcgtgagaatcacgccgattatgtcccacacgcctttcacgtgactct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
5986312 |
ggaaactacggacgagtcgtcccttgattttctgcatcgctttgctgtatttgcgtgagaatcacgccgactatgtcccacacgcctttcacgtgactct |
5986213 |
T |
|
| Q |
201 |
attc |
204 |
Q |
| |
|
|||| |
|
|
| T |
5986212 |
attc |
5986209 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University