View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2056_low_12 (Length: 230)
Name: NF2056_low_12
Description: NF2056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2056_low_12 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 14 - 230
Target Start/End: Original strand, 27508226 - 27508440
Alignment:
| Q |
14 |
aaaggaactaactaactttcagtttttgtagttttatggttggcaagttcctttcttcttctcttcactctctttcaatttctaatcacatgcatcacga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27508226 |
aaaggaactaactaactttcagtttttgtagttttatggttggcaagttcctttcttcttctcttcactctctttcaatttctaatcacatgcatcacga |
27508325 |
T |
 |
| Q |
114 |
ttatatatttcataaaaaatgggctaaggagttttnnnnnnnntataataacaaactgcaataattaaatttgactaaatcatgaaatggaggattgttg |
213 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27508326 |
ttatatatttcat--aaaatgggctaaggagttttttaaaaaatataataacaaactgcaataattaaatttgactaaatcaccaaatggaggattgttg |
27508423 |
T |
 |
| Q |
214 |
atcaatgactttgagcc |
230 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
27508424 |
atcaatgactttgagcc |
27508440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University