View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2056_low_13 (Length: 206)

Name: NF2056_low_13
Description: NF2056
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2056_low_13
NF2056_low_13
[»] chr1 (1 HSPs)
chr1 (12-188)||(39998250-39998427)


Alignment Details
Target: chr1 (Bit Score: 138; Significance: 2e-72; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 138; E-Value: 2e-72
Query Start/End: Original strand, 12 - 188
Target Start/End: Complemental strand, 39998427 - 39998250
Alignment:
12 gagatgaatatgaccatgaaaaaagacaatctcagccagc----atggtgtcttcaaaagaagacaggatgcaacttgcataggatccaaattgctatat 107  Q
    ||||||||||||||||||||||||||||||||||||||||    ||||||||||||||||||||||||||||||||| |||||||| |||||||||||||    
39998427 gagatgaatatgaccatgaaaaaagacaatctcagccagccagcatggtgtcttcaaaagaagacaggatgcaacttacataggattcaaattgctatat 39998328  T
108 aggacaaaatggtattagtaatagttttggtaaaccaatgaaactgtaatatccaacaaatcattcttcacatcctttaat 188  Q
    |||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
39998327 aggacaaaatg---atagtaatagttttggtaaaccaatgaaactgtaatatccaacaaatcattcttcacatcctttaat 39998250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University