View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20570_high_24 (Length: 396)

Name: NF20570_high_24
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20570_high_24
NF20570_high_24
[»] chr6 (2 HSPs)
chr6 (87-165)||(4664672-4664750)
chr6 (21-54)||(4664611-4664644)


Alignment Details
Target: chr6 (Bit Score: 59; Significance: 7e-25; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 87 - 165
Target Start/End: Original strand, 4664672 - 4664750
Alignment:
87 ttatgaaagctaatatatattttttaaactatagaatcgactgcaataaccgtaattttagaatcacattcaactgtca 165  Q
    ||||||||| |||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| |||||    
4664672 ttatgaaagttaatatttattttttaaactatagaatcgactgcattaaccttaattttagaatcacattcaaatgtca 4664750  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 54
Target Start/End: Original strand, 4664611 - 4664644
Alignment:
21 cttgatatttagctctatcacgacggattattct 54  Q
    |||||||||||||||||||||||||| |||||||    
4664611 cttgatatttagctctatcacgacgggttattct 4664644  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University