View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_high_26 (Length: 360)
Name: NF20570_high_26
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_high_26 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 85 - 341
Target Start/End: Complemental strand, 53279272 - 53279016
Alignment:
| Q |
85 |
gaaatcggtaagtcatacatgtaattaagttgtttatataaaactaaccaaaaggaaactagaagaactggtgtatatattttcgaagaagaggatttaa |
184 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53279272 |
gaaatcggtaagtcctacatgtaattaagttgtttatataaaactaaccaaaaggaaactagaagaactggtgtatatattttcgaagaagaggatttaa |
53279173 |
T |
 |
| Q |
185 |
gagcttgctgtaaacactctccgagggatgaaaactgtcccagaaaacgtagtccctaacatcttcacattgggtagcaaattggttgcataacactgct |
284 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53279172 |
gagcttgctgtaaacactctctgagggatgaaaactgtcccagaaaacgtagtccctaacatcttcacattgggtagcaaattggttgcataacactgct |
53279073 |
T |
 |
| Q |
285 |
acctctactgctcctgtgccacaacatcctttgtcaacgactttataacctgccatt |
341 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53279072 |
acctctactgctcctgtgccacaacatcctttgtcaacgactttataacctgccatt |
53279016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 2e-28
Query Start/End: Original strand, 16 - 84
Target Start/End: Complemental strand, 53279380 - 53279312
Alignment:
| Q |
16 |
atcgatgtagatgatgtccccttaaaacacaaaataatttatttaatgtacctcatcaaccatacactt |
84 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53279380 |
atcgatgtagatgatatccccttaaaacacaaaataatttatttaatgtacctcatcaaccatacactt |
53279312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University