View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_high_32 (Length: 332)
Name: NF20570_high_32
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_high_32 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 297; Significance: 1e-167; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 297; E-Value: 1e-167
Query Start/End: Original strand, 1 - 320
Target Start/End: Complemental strand, 29946442 - 29946122
Alignment:
| Q |
1 |
tagcactatagcgcctgcctatgtaactgctatttgacaacactttttattaatcccgtgttgcataataaaagtggtttgttcaaattatgttaagcta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29946442 |
tagcactatagcgcctgcctatgtaactgctatttggcaacactttttattaatcccgtgttgcataataaaagtggtttgttcaaattatgttaagcta |
29946343 |
T |
 |
| Q |
101 |
tagccgctattttgacaacattgattcgaagtcgctgcagttattttcttttaactttgtatcagtgtaggatatgt-ttttatatattgctgatttgag |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
29946342 |
tagccgctattttgacaacattgattcgaagtcgctgcagttattttcttttaactttgtatcagtgtaggatatgttttttatatattgctgatttgag |
29946243 |
T |
 |
| Q |
200 |
ttccgaatttgtagtgttccacagctgaagactgtcgttcagttacttgcaaatatggaaagcagccagcttagttcactatcccgaacccatgttcttg |
299 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29946242 |
ttcaaaatttgtagtgttccacagctgaagactgtcgttcagttacttgcaaatatggaaagtagccagcttagttcactatcccgaacccatgttcttg |
29946143 |
T |
 |
| Q |
300 |
agaaggtatggatatgatgat |
320 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
29946142 |
agaaggtatggatatgatgat |
29946122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University