View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_high_7 (Length: 496)
Name: NF20570_high_7
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_high_7 |
 |  |
|
| [»] scaffold0008 (10 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 108; Significance: 5e-54; HSPs: 10)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 50 - 161
Target Start/End: Complemental strand, 7619 - 7508
Alignment:
| Q |
50 |
aggaaatgaattggaaatgatgataagtgcgttgtattgatatgatataaacgataattaagttgatagaaatccatcctagaaatctatcttgattgat |
149 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7619 |
aggaaatgaattggaaatgatgataagtgtgttgtattgatatgatataaacgataattaagttgatagaaatccatcctagaaatctatcttgattgat |
7520 |
T |
 |
| Q |
150 |
atgtttattctt |
161 |
Q |
| |
|
|||||||||||| |
|
|
| T |
7519 |
atgtttattctt |
7508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 377 - 474
Target Start/End: Complemental strand, 7288 - 7191
Alignment:
| Q |
377 |
gattaattctctaagctataaaatatccagacccttcctcaaagcttaaatgttgatgcgtcaagtttggggaaacctacaaatacaatttctctgtc |
474 |
Q |
| |
|
|||||||||| ||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
7288 |
gattaattctttaagctatacaatatccatacccttcctcaaagcttaaatgttgatgcgtcaagtttgaggaaacctacaaatacaatttctttgtc |
7191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #3
Raw Score: 78; E-Value: 4e-36
Query Start/End: Original strand, 377 - 474
Target Start/End: Complemental strand, 17849 - 17752
Alignment:
| Q |
377 |
gattaattctctaagctataaaatatccagacccttcctcaaagcttaaatgttgatgcgtcaagtttggggaaacctacaaatacaatttctctgtc |
474 |
Q |
| |
|
|||||||||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
17849 |
gattaattctctaagctatacaatatccaaacccttcctccaagcttaaatgttgatgcgtcaagtttgaggaaacctacaaatacaatttctttgtc |
17752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #4
Raw Score: 68; E-Value: 4e-30
Query Start/End: Original strand, 62 - 161
Target Start/End: Complemental strand, 18166 - 18072
Alignment:
| Q |
62 |
ggaaatgatgataagtgcgttgtattgatatgatataaacgataattaagttgatagaaatccatcctagaaatctatcttgattgatatgtttattctt |
161 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18166 |
ggaaatgatgataagtgcgttgtat-----cgatataaactataattaagttgatagaaatccatcctagatatctatcttgattgatatgtttattctt |
18072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #5
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 229 - 296
Target Start/End: Complemental strand, 5718 - 5651
Alignment:
| Q |
229 |
ctacactctccatgattggatgggggagatatttctttttataaattcttctcttaaagaagcatcac |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5718 |
ctacactctccatgattggatgggggagataattctttttataatttcttctcttaaagaagcatcac |
5651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #6
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 229 - 296
Target Start/End: Complemental strand, 17997 - 17930
Alignment:
| Q |
229 |
ctacactctccatgattggatgggggagatatttctttttataaattcttctcttaaagaagcatcac |
296 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
17997 |
ctacactctctatgattggatgggggagatatttctttttataaattcttctgttaaagaagcatcac |
17930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #7
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 229 - 296
Target Start/End: Complemental strand, 16493 - 16426
Alignment:
| Q |
229 |
ctacactctccatgattggatgggggagatatttctttttataaattcttctcttaaagaagcatcac |
296 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
16493 |
ctacactctccatgattggatggggaagataattctttttataatttcttctcttaaagaagcatcac |
16426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 229 - 280
Target Start/End: Complemental strand, 7433 - 7382
Alignment:
| Q |
229 |
ctacactctccatgattggatgggggagatatttctttttataaattcttct |
280 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7433 |
ctacactctctatgattggatgggggagatatttctttttataaattcttct |
7382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 405 - 467
Target Start/End: Complemental strand, 16318 - 16256
Alignment:
| Q |
405 |
agacccttcctcaaagcttaaatgttgatgcgtcaagtttggggaaacctacaaatacaattt |
467 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||| ||| |||| |||||||| |
|
|
| T |
16318 |
agacccttcctcaaagcttaaatgttgatgcgtcaagtttgaggatacccacaagtacaattt |
16256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #10
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 377 - 463
Target Start/End: Complemental strand, 5571 - 5485
Alignment:
| Q |
377 |
gattaattctctaagctataaaatatccagacccttcctcaaagcttaaatgttgatgcgtcaagtttggggaaacctacaaataca |
463 |
Q |
| |
|
||||||||||||||| | || | | | ||||||||||||||||||||||||||||||| |||||||||| ||| ||| |||| |||| |
|
|
| T |
5571 |
gattaattctctaaggtttacatttttcagacccttcctcaaagcttaaatgttgatgtgtcaagtttgaggatacccacaagtaca |
5485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 50; Significance: 2e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 377 - 474
Target Start/End: Original strand, 25364526 - 25364622
Alignment:
| Q |
377 |
gattaattctctaagctataaaatatccagacccttcctcaaagcttaaatgttgatgcgtcaagtttggggaaacctacaaatacaatttctctgtc |
474 |
Q |
| |
|
||||||||||||||| | || ||| | |||||||||||| |||||||||||||||||||||||||||| | || ||| ||||||||||||||| |||| |
|
|
| T |
25364526 |
gattaattctctaagttttacaattttcagacccttccttaaagcttaaatgttgatgcgtcaagttt-gagatacccacaaatacaatttctttgtc |
25364622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 240 - 296
Target Start/End: Original strand, 25364389 - 25364445
Alignment:
| Q |
240 |
atgattggatgggggagatatttctttttataaattcttctcttaaagaagcatcac |
296 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| | ||||| ||||| |
|
|
| T |
25364389 |
atgattggatgggggagatatttctttttataaattcttctctaagagaagaatcac |
25364445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University