View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_low_24 (Length: 396)
Name: NF20570_low_24
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_low_24 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 59; Significance: 7e-25; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 87 - 165
Target Start/End: Original strand, 4664672 - 4664750
Alignment:
| Q |
87 |
ttatgaaagctaatatatattttttaaactatagaatcgactgcaataaccgtaattttagaatcacattcaactgtca |
165 |
Q |
| |
|
||||||||| |||||| |||||||||||||||||||||||||||| ||||| ||||||||||||||||||||| ||||| |
|
|
| T |
4664672 |
ttatgaaagttaatatttattttttaaactatagaatcgactgcattaaccttaattttagaatcacattcaaatgtca |
4664750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 21 - 54
Target Start/End: Original strand, 4664611 - 4664644
Alignment:
| Q |
21 |
cttgatatttagctctatcacgacggattattct |
54 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |
|
|
| T |
4664611 |
cttgatatttagctctatcacgacgggttattct |
4664644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University