View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_low_25 (Length: 383)
Name: NF20570_low_25
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_low_25 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 319; Significance: 1e-180; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 319; E-Value: 1e-180
Query Start/End: Original strand, 13 - 367
Target Start/End: Complemental strand, 3294996 - 3294642
Alignment:
| Q |
13 |
taagatcgtctgctatcaactagctaatcagttatccattacnnnnnnnnaccaaacagattttaaataaagtctaaacatttcattacctgtggcctag |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
3294996 |
taagatcgtctgctatcaactagctaatcagttatccattactcttttttaccaaacagattttaaacaaagtctaaacatttcattacctgtggcctag |
3294897 |
T |
 |
| Q |
113 |
gtcttcttggtctagaccttctaaacttctgcaaattactcgcattagcaacaccaagaacagcagattcatacgtagcaaaattccccaccattctctt |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294896 |
gtcttcttggtctagaccttctaaacttgtgcaaattactcgcattagcaacaccaagaacagcagattcatacgtagcaaaattccccaccattctctt |
3294797 |
T |
 |
| Q |
213 |
ctcagactccaacccaacatatgcctcaaccctattcaccactgcctcacccacccactgaaccgaattaaacaacaaccctaactccgccggaactgaa |
312 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3294796 |
ctcagactccaacccaacatatgcctcaaccctattcaccactgcctcacccacccactgaaccgaattaaacaacaaccctaactccgccggaactgaa |
3294697 |
T |
 |
| Q |
313 |
tcaaacccacaagctgaaaccaccaacgaaccggtctcaactgcccgttgatggt |
367 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
3294696 |
tcaaacccacaagctgaaaccaccaacgaaccggtctcaactgccctttgatggt |
3294642 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University