View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_low_51 (Length: 265)
Name: NF20570_low_51
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_low_51 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 4 - 253
Target Start/End: Complemental strand, 48642109 - 48641860
Alignment:
| Q |
4 |
tttgtgcccccattagtattaactagttcagttagtaagaatcataatgcatcaagaatgtcagggccttggtataacaagctctattggaccagaagta |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48642109 |
tttgtgcccccattagtattaactagttcagttagtaagaatcaaaatgcatcaaggatgtcagggccttggtataacaagctctattggaccagaagta |
48642010 |
T |
 |
| Q |
104 |
gagagaaagaaaggaggcatgttttgaaggatgcaatgcaggtatatgatttaagatttcaaccataagtatataataataaaaccaaaataatctatta |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48642009 |
gagagaaagaaaggaggcatgttttgaaggatgcaatgcaggtatatgatttaagatttcaaccataagtatataataataaaaccaaaataatctatta |
48641910 |
T |
 |
| Q |
204 |
ataaaggaaaccaaagcatcaccttataatggtaccctgctgccaccttc |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48641909 |
ataaaggaaaccaaagcatcaccttataatggtaccctgctgccaccttc |
48641860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University