View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_low_52 (Length: 264)
Name: NF20570_low_52
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_low_52 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 19 - 256
Target Start/End: Original strand, 42629669 - 42629906
Alignment:
| Q |
19 |
atactcatagtcattgagtggttagggaatttgaagatgagttttaggttcgacgatggaagatgagtttctaaacgtgcgatgaaagtaagtcacatgc |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42629669 |
atactcatagtcattgagtggttagggaatctgaagatgagttttaggttcgacgatggaagatgagtttctaaacgtgcgatgaaagtaagtcacatgc |
42629768 |
T |
 |
| Q |
119 |
gggaagcggcggtacagtggtgaaagaagtctgggagaccaaattcaaccaatcttcattcagcgacaccnnnnnnncactaatatgtgttgattttcta |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
42629769 |
gggaagcggcggtacagtggtgaaagaagtctgggagaccaaattcaaccaatcttcattcagcgacaccaaaaaaacactaatatgtgttgattttcta |
42629868 |
T |
 |
| Q |
219 |
ctttctttgacttacatttctaggttctgattcattga |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42629869 |
ctttctttgacttacatttctaggttctgattcattga |
42629906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University