View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_low_61 (Length: 252)
Name: NF20570_low_61
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_low_61 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 156; Significance: 6e-83; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 156; E-Value: 6e-83
Query Start/End: Original strand, 67 - 238
Target Start/End: Complemental strand, 1881193 - 1881022
Alignment:
| Q |
67 |
gttgaaataccaggtcctagtaatctgaactacgaccataaatgacttaatttatttattctcacgtgacaaaattataagactagtatgtactgtacaa |
166 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1881193 |
gttgaaataccaggccctagtaatctgaactactaccataaatgacttaatttatttattctcacgtgataaaattataagactagtatgtactgtacaa |
1881094 |
T |
 |
| Q |
167 |
ctttttaatcgccgtatttcgacgaaatttactgcaagaataatagaatgaattgagtgacttaggaaatat |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1881093 |
ctttttaatcgccgtatttcgacgaaatttactgcaagaataatagtatgaattgagtgacttaggaaatat |
1881022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University