View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_low_66 (Length: 248)
Name: NF20570_low_66
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_low_66 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 10 - 216
Target Start/End: Original strand, 36165784 - 36165991
Alignment:
| Q |
10 |
gtctataatttt-ttctagattaccttaggaaaattgttggaaatttactcatcaaaaaataaaagttatccacaagtaaagtaaaaattagtttgtggt |
108 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
36165784 |
gtctataatttttttctagattaccttaggaaaattgttggaaatttactcatcaaacaataaaaattatccacaagtaaagtaaaaattagtttgtggt |
36165883 |
T |
|
| Q |
109 |
taccacttacgactttactaatgtaactaattttgattaattatggtaaatcacatctaattcttcgaagctagcgtaggcatcaactaagtccattgtt |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
36165884 |
taccacttacaactttactaatgtaactaattttgattaattatggtaaatcacatctaattcttcgaagcaagcgtaggcatgaactaagtccattgtt |
36165983 |
T |
|
| Q |
209 |
tgatccgt |
216 |
Q |
| |
|
|||||||| |
|
|
| T |
36165984 |
tgatccgt |
36165991 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University