View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_low_74 (Length: 240)
Name: NF20570_low_74
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_low_74 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 60 - 220
Target Start/End: Complemental strand, 42985709 - 42985550
Alignment:
| Q |
60 |
gtagatcgatgtaaatatgaacattaatacccacaactcttgattcttcctccttaattaaaaacaatgaagtagtannnnnnnnctttggaaa--ctct |
157 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |||| |
|
|
| T |
42985709 |
gtagatcgatgtaaatatgaacattaatacccacaactcttgattcttcctccttaattaaaaacaatgaagtatt---ttttttctttggaaactctct |
42985613 |
T |
 |
| Q |
158 |
ctctcatatgttttacattttccaacgttgttgataaactaacttctcttgagtcttttgtat |
220 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42985612 |
ctctcatatgatttacattttccaacgttgttgataaactaacttctcttgagtcttttgtat |
42985550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University