View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20570_low_84 (Length: 222)
Name: NF20570_low_84
Description: NF20570
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20570_low_84 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 26 - 204
Target Start/End: Original strand, 3039811 - 3039992
Alignment:
| Q |
26 |
aaaaacataatgtt-aattttgatagattttatattgtataagtcatttatgatgttatctcggatgtcagggttgtgcaagggcaatactagctaggat |
124 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
3039811 |
aaaaacataatgtttaattttgatagattttatattgtataagtcatttatgatgttatctcggatgccagggttgtgcaagggcgatactagctaggat |
3039910 |
T |
 |
| Q |
125 |
gctacggggtggtaatggatcttggtctctatcatagga--tggtacccaatttgtagaattctgctattctcccaacacat |
204 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||| ||||||||| |
|
|
| T |
3039911 |
gctacggggtggtaatggatcttggtctctatcataggatgtggtacccaatttgtagaattatgctattcttccaacacat |
3039992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University