View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20571_high_10 (Length: 243)
Name: NF20571_high_10
Description: NF20571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20571_high_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 92 - 191
Target Start/End: Complemental strand, 3686650 - 3686549
Alignment:
| Q |
92 |
ttcattttggtagaaacaccctttacacttttcaacacaacnnnnnnnattaactactac---caagatatctaatagggctagtcaaaaaataagaata |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| | |||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3686650 |
ttcattttggtagaaacaccctttacacttttcaacact-ccttttttattaactactactaccaagatatctaatagggctagtcaaaaaataaggata |
3686552 |
T |
 |
| Q |
189 |
cca |
191 |
Q |
| |
|
||| |
|
|
| T |
3686551 |
cca |
3686549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University