View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20571_high_3 (Length: 439)
Name: NF20571_high_3
Description: NF20571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20571_high_3 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 399; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 399; E-Value: 0
Query Start/End: Original strand, 18 - 428
Target Start/End: Complemental strand, 29319384 - 29318974
Alignment:
| Q |
18 |
acaagaagaagatggagatctaccttcaaacacaaaattggatagaaaaagcaaagccatttatagcagttttgtttttgcaatttggatatgcaattat |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319384 |
acaagaagaagatggagatctaccttcaaacacaaaattggatagaaaaagcaaagccatttatagcagttttgtttttgcaatttggatatgcaattat |
29319285 |
T |
|
| Q |
118 |
ggatgttctatcaaaggctgcattgaacagaggaatgagcaactatgtatttgttgtgtaccgccatgccgttgcattcattgttataaccccttttgca |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319284 |
ggatgttctatcaaaggctgcattgaacagaggaatgagcaactatgtatttgttgtgtaccgccatgccgttgcattcattgttataaccccttttgca |
29319185 |
T |
|
| Q |
218 |
ctctattttgataggtataatcctctctccatctatatgtttgtgttttatttggtttggaattcactacttggttcttctttgcaaagtcttaaattta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29319184 |
ctctattttgataggtataatcctctctccatctatatgtttgtgttttatttggtttggaattcactacttggttcttctttgcaaagtcttaaattta |
29319085 |
T |
|
| Q |
318 |
gggagagaaaaatctaaatttgtcaacaatgacccctacaacaaggaccaggtttccctagctgtattattttcctgcagtttcacgctataatagattg |
417 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||| |
|
|
| T |
29319084 |
gggagagaaaaatctaaatttgtcaacaatgacccctacaacaaggaccaggtttccctagctgtattattttcctgcagtttcacgttgtaatagatta |
29318985 |
T |
|
| Q |
418 |
tggccgttcat |
428 |
Q |
| |
|
||||||||||| |
|
|
| T |
29318984 |
tggccgttcat |
29318974 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University