View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20571_high_7 (Length: 259)
Name: NF20571_high_7
Description: NF20571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20571_high_7 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 232; Significance: 1e-128; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 232; E-Value: 1e-128
Query Start/End: Original strand, 5 - 244
Target Start/End: Original strand, 9437923 - 9438162
Alignment:
| Q |
5 |
cattacccaaaacaagaaagtgtcttcttcgatcaaaactatgattcaaatttgttataactactaaaaatatctttgttgcttcacaacgaactccatc |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9437923 |
cattacccaaaacaagaaagtgtcttcttcgatcaaaactatgattcaaatttgttataactactaaaaatatctttgttgcttcacaacgaactccatc |
9438022 |
T |
|
| Q |
105 |
aatcagattatctcaaacagtacatttcttatatttgaatttttatccccacgaccaactttatgcacccgctaattcaacaatgttcattttggaatca |
204 |
Q |
| |
|
||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9438023 |
aatcaaattatctcaagcagtacatttcttatatttgaatttttatccccacgaccaactttatgcacccgctaattcaacaatgttcattttggaatca |
9438122 |
T |
|
| Q |
205 |
actagaggctcaaccataattacaaatatatgaagcatat |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9438123 |
actagaggctcaaccataattacaaatatatgaagcatat |
9438162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University