View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20571_low_12 (Length: 243)

Name: NF20571_low_12
Description: NF20571
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20571_low_12
NF20571_low_12
[»] chr8 (1 HSPs)
chr8 (92-191)||(3686549-3686650)


Alignment Details
Target: chr8 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 92 - 191
Target Start/End: Complemental strand, 3686650 - 3686549
Alignment:
92 ttcattttggtagaaacaccctttacacttttcaacacaacnnnnnnnattaactactac---caagatatctaatagggctagtcaaaaaataagaata 188  Q
    ||||||||||||||||||||||||||||||||||||||  |       ||||||||||||   ||||||||||||||||||||||||||||||||| |||    
3686650 ttcattttggtagaaacaccctttacacttttcaacact-ccttttttattaactactactaccaagatatctaatagggctagtcaaaaaataaggata 3686552  T
189 cca 191  Q
    |||    
3686551 cca 3686549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University